ID: 1094316707

View in Genome Browser
Species Human (GRCh38)
Location 12:29144243-29144265
Sequence CTCGTTACTGACCAGTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 1, 2: 12, 3: 49, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094316702_1094316707 15 Left 1094316702 12:29144205-29144227 CCCAAGGATGTAAAACAAGATGG 0: 6
1: 26
2: 81
3: 125
4: 249
Right 1094316707 12:29144243-29144265 CTCGTTACTGACCAGTTTGCTGG 0: 1
1: 1
2: 12
3: 49
4: 132
1094316704_1094316707 14 Left 1094316704 12:29144206-29144228 CCAAGGATGTAAAACAAGATGGA 0: 16
1: 31
2: 69
3: 90
4: 305
Right 1094316707 12:29144243-29144265 CTCGTTACTGACCAGTTTGCTGG 0: 1
1: 1
2: 12
3: 49
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094316707 Original CRISPR CTCGTTACTGACCAGTTTGC TGG Intergenic
902118227 1:14139467-14139489 CTCTTTCCTGAACACTTTGCTGG + Intergenic
902947137 1:19849761-19849783 TTTGTTACTGACCAACTTGCTGG + Intergenic
903980151 1:27180469-27180491 GACATGACTGACCAGTTTGCTGG - Intergenic
904132007 1:28282150-28282172 CTCCTCTCTGACCAGTTTGGAGG + Exonic
904629098 1:31828215-31828237 CTTCTTAATGACCAGTTTTCTGG + Intergenic
909064735 1:70921605-70921627 TTTATAACTGACCAGTTTGCTGG - Intronic
909575712 1:77173779-77173801 TTTGTTATTGACCAGCTTGCTGG - Intronic
910023784 1:82624122-82624144 TTTGTAATTGACCAGTTTGCTGG - Intergenic
911907953 1:103593846-103593868 TTTGTTACTAACCAGTTTACAGG + Intergenic
912954263 1:114142735-114142757 CTGCTGACTGACCAGTTTGGTGG - Intronic
916640271 1:166720689-166720711 GACATGACTGACCAGTTTGCTGG - Intergenic
921077094 1:211708514-211708536 TTTGTTACTGACCAGCTTGCAGG - Intergenic
1065807446 10:29407974-29407996 TTTGTAACTGACCAGCTTGCTGG + Intergenic
1066977002 10:42378283-42378305 GACTTAACTGACCAGTTTGCTGG + Intergenic
1067823142 10:49548674-49548696 TTTGTTACTGACCAGCTTGCTGG + Intergenic
1068480001 10:57578328-57578350 TTTGTTACTGACCATTTTGTTGG + Intergenic
1071392378 10:85189010-85189032 TTTGTTGCTGACCAGCTTGCTGG + Intergenic
1075264906 10:120991774-120991796 TTCGTTACTGACCAGTTTGCGGG - Intergenic
1080075008 11:28138805-28138827 TTTGTTACTGCCCAGTTTGCTGG + Intronic
1080249048 11:30212624-30212646 CTGGTTAATGTCCAGTTAGCAGG - Intergenic
1082121361 11:48383403-48383425 TTTGTTACTGACCATTTTGTTGG + Intergenic
1082252504 11:49997227-49997249 TTTGTTACTGACCATTTTGTTGG - Intergenic
1082555349 11:54557654-54557676 TTTGTTACTGACCATTTTGTTGG + Intergenic
1082866778 11:57907284-57907306 TTTGTTACTAACCAGTTTGCTGG + Intergenic
1083011244 11:59401807-59401829 TTTGTTATTGATCAGTTTGCTGG - Intergenic
1084765917 11:71308224-71308246 CTGGTTAATGAGCAATTTGCTGG + Intergenic
1085480294 11:76816590-76816612 GACATGACTGACCAGTTTGCTGG + Intergenic
1087338193 11:96869380-96869402 CTCTTTACTGACAAATTTCCTGG - Intergenic
1093920765 12:24856807-24856829 TTTGTAACTGACCAGTTTGCGGG - Intronic
1094100236 12:26753806-26753828 TTTGTAACTGGCCAGTTTGCTGG - Intronic
1094239931 12:28210978-28211000 GTTATTACTGACCAGTTTGCTGG + Intronic
1094316707 12:29144243-29144265 CTCGTTACTGACCAGTTTGCTGG + Intergenic
1095602542 12:44029819-44029841 TTTTTAACTGACCAGTTTGCTGG - Intronic
1097157001 12:57019398-57019420 CACGAAACTGACCAGTTTGCAGG - Intronic
1098296677 12:69011147-69011169 CTGGTCACTGACCAGTATGTAGG + Intergenic
1099402040 12:82211953-82211975 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1101383567 12:104235763-104235785 TTTGTTACTGACCATTTTGTTGG - Intronic
1103271992 12:119681097-119681119 CTCAGGACTGACCAGTTAGCTGG + Exonic
1103682332 12:122704312-122704334 TTTCTTACTGACCAGTTTCCTGG - Intergenic
1103684067 12:122717755-122717777 TTTCTTACTGACCAGTTTCCTGG - Intergenic
1105778361 13:23683228-23683250 GACATGACTGACCAGTTTGCTGG - Intergenic
1105823427 13:24100022-24100044 CTCTTTGCTGACCAGAGTGCTGG + Intronic
1109609041 13:64739269-64739291 TTTGTAACTGACCAGCTTGCTGG - Intergenic
1114334846 14:21677469-21677491 TTTGTTACTGACCAGCTTGCTGG - Intergenic
1116329543 14:43578280-43578302 TTTGTTACTGACCAGCTTTCTGG - Intergenic
1116678765 14:47939391-47939413 TTTGTTACTGAACAGCTTGCTGG - Intergenic
1126726294 15:51635867-51635889 TTTGTAACTGACCAGTTTCCTGG + Intergenic
1130036889 15:80369059-80369081 TTTGTTACTGACCATTTTGTTGG - Intronic
1132948089 16:2543690-2543712 GTCTTTTCTGACCAGTCTGCTGG + Intronic
1135144757 16:19951501-19951523 TTTGTAACTGACCAGTCTGCTGG - Intergenic
1144426442 17:15146854-15146876 TTTCTTACTGACCAGCTTGCTGG - Intergenic
1144603043 17:16636230-16636252 CTCTTTACTTACCAGTTTCCAGG - Intronic
1145898564 17:28474983-28475005 CTTGTTACTGACCAGGTGTCAGG - Intronic
1148626679 17:49074758-49074780 TTTGTTACTGGCCAGTTTGCTGG + Intergenic
1154365287 18:13702422-13702444 TTCGTTACTGACCAGCTTGCTGG - Intronic
1155523012 18:26688299-26688321 CACGTTACTGAGCAGATTCCTGG - Intergenic
1158995986 18:62920254-62920276 CACTTTACTGACCATTTTGTAGG + Intronic
1160607649 18:80064548-80064570 TTTATAACTGACCAGTTTGCTGG + Intronic
1161479564 19:4503746-4503768 CTTGAGACTGAGCAGTTTGCAGG - Exonic
1163455475 19:17403668-17403690 CTCCTCACTGACCAGCTTCCTGG + Exonic
1166327516 19:42060176-42060198 CTTGTTACTGCCCAGACTGCGGG + Intronic
1168548826 19:57276669-57276691 TTTGTTACTGACCAGTTTGCTGG + Intergenic
926503641 2:13684265-13684287 TTTGTTACTGACCACTTTGTTGG - Intergenic
926521723 2:13923771-13923793 TTTGTTACTGACCAGATTGCTGG - Intergenic
926927019 2:17997041-17997063 TTTGTTACTGACCAGTTTGCTGG - Intronic
928382217 2:30828252-30828274 TTTGTTACTGACCAGCTTGCTGG - Intergenic
928459310 2:31456016-31456038 TTTGTTACTGACCAGCTTGCTGG + Intergenic
928834047 2:35522188-35522210 TTTGCCACTGACCAGTTTGCTGG + Intergenic
929153052 2:38765340-38765362 CTCGTTACTGATCAGATTCTTGG - Intronic
929579731 2:43074244-43074266 CACCTTTCTGACCAGCTTGCAGG + Intergenic
933614335 2:84468967-84468989 TTTGTTACTGACCAGCTTGTTGG + Intergenic
937882719 2:126880569-126880591 CGTGTCACTGACCAGTTTGAGGG - Intergenic
939843702 2:147219352-147219374 TTTGTAACTGACCAGTTTGCTGG + Intergenic
941639546 2:167972419-167972441 AACCTAACTGACCAGTTTGCTGG - Intronic
942301484 2:174567077-174567099 TTCGTTTCTTGCCAGTTTGCTGG + Exonic
942620235 2:177837313-177837335 TTTGTTACTGACCAGTTTGCTGG - Intronic
942767228 2:179470826-179470848 TTTGTAACTGACCAGCTTGCTGG - Intronic
944833089 2:203552080-203552102 CTGGTGATTGACCTGTTTGCAGG - Intergenic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1171319132 20:24223821-24223843 TTTATTACTGACCAGCTTGCTGG + Intergenic
1171442224 20:25174431-25174453 TTTGTAACTGACCAGTTTGCTGG + Intergenic
1172235514 20:33370448-33370470 ATCATTCCTGACCAGTTTGGGGG - Intronic
1173752172 20:45486071-45486093 TTTGTAACTGACCAGTGTGCCGG + Intergenic
1178435862 21:32557969-32557991 TTTATAACTGACCAGTTTGCTGG + Intergenic
1183325938 22:37194196-37194218 TTTGTAACTGACGAGTTTGCTGG + Intronic
1184793931 22:46720228-46720250 CTCGTTAGTGCAAAGTTTGCAGG + Intronic
951249939 3:20382717-20382739 TTTGTTATTGACCAGCTTGCTGG - Intergenic
952123861 3:30276415-30276437 GTTGTTACTGACCAGCTTGCTGG - Intergenic
953153338 3:40344945-40344967 TTTGTTACTGACCAGTTTGTTGG - Intergenic
953416226 3:42719623-42719645 TTTGTAACTGACCAGTTTGCTGG - Intronic
957604323 3:82377833-82377855 TTTGTAACTGGCCAGTTTGCTGG + Intergenic
957716017 3:83930176-83930198 TTTGTTACTGACCAGTTTACCGG - Intergenic
958956238 3:100468143-100468165 TTTGATACTGACCAGTTTGTTGG - Intergenic
959179854 3:102964292-102964314 CTCATTAGTGATCATTTTGCAGG + Intergenic
960514767 3:118591104-118591126 TTTATAACTGACCAGTTTGCTGG - Intergenic
965149556 3:164952266-164952288 TTTGTTACTGACCAGCTTGCTGG - Intergenic
965585902 3:170318181-170318203 TTTCTTACTGACCAGCTTGCTGG + Intergenic
965588512 3:170341073-170341095 CTTGTTACTGACCAGCTTGCTGG + Intergenic
966146874 3:176822677-176822699 CTTGTTACTGACCAGCTTGCTGG + Intergenic
971968702 4:33594490-33594512 TTTGTTACTGACCATTTTGTTGG - Intergenic
972285945 4:37648377-37648399 CTCGTTCCTTGCCAGCTTGCTGG - Intronic
974072749 4:57140162-57140184 TTGGTAACTGACCAGTTTGCTGG + Intergenic
974614494 4:64264682-64264704 GACGTAACTGACCAGTTTGTTGG + Intergenic
976461580 4:85318967-85318989 TTTGTTACTGACCAGTTTGCTGG + Intergenic
976643525 4:87363479-87363501 TTTGTTACTGACCAGCTTGCTGG - Intronic
977674354 4:99731692-99731714 TTTGTTACAGACCAGCTTGCCGG + Intergenic
978019412 4:103788719-103788741 TTTGTTACTGACCATTTTGTTGG - Intergenic
979014968 4:115420660-115420682 TTTGTTACTGGGCAGTTTGCTGG - Intergenic
979866768 4:125765425-125765447 CTCAATACATACCAGTTTGCAGG - Intergenic
981201015 4:141979522-141979544 TTTGTTACTGACCAGGTTGCTGG - Intergenic
981233527 4:142387868-142387890 GACATGACTGACCAGTTTGCTGG - Intronic
982399606 4:154952503-154952525 TTTGTTACTGACAAGTTTGTGGG + Intergenic
982602674 4:157471124-157471146 TTCGTTACTGACTAGTTTGCTGG - Intergenic
982606865 4:157526824-157526846 TTTGTTACTAACCAGTTTGCTGG + Intergenic
983773838 4:171582497-171582519 TTTGTTACTGACCAATTTGCTGG + Intergenic
984441394 4:179774859-179774881 TTTGTAACTGACCAGATTGCTGG - Intergenic
987166205 5:15201264-15201286 TTTGTTACTGACCAGTTTGCTGG + Intergenic
987951869 5:24686812-24686834 CCCCTTACTCACCAGTTTGTGGG - Intergenic
988778191 5:34496098-34496120 CTCAGAAATGACCAGTTTGCAGG - Intergenic
989337056 5:40330436-40330458 TTTGTTATTGACCAGCTTGCTGG + Intergenic
990290534 5:54346178-54346200 TTTGTTACTGACCAGCTTGCTGG - Intergenic
993248522 5:85484177-85484199 TTTTTTATTGACCAGTTTGCTGG - Intergenic
993745565 5:91592938-91592960 TTTGTTACTGACCAGTTTGCTGG + Intergenic
993939495 5:94041323-94041345 GACATGACTGACCAGTTTGCTGG - Intronic
994562581 5:101395076-101395098 TTTGTTACTGACCAGATTGCTGG - Intergenic
1000061113 5:157655959-157655981 TTTTTAACTGACCAGTTTGCTGG - Intronic
1000415696 5:160981361-160981383 GACATGACTGACCAGTTTGCTGG - Intergenic
1000741241 5:164973000-164973022 TTTGTTACTGACCAGTTTGCTGG + Intergenic
1004765532 6:18722343-18722365 TTTGTTACTGACCAGCTTGCTGG - Intergenic
1008291448 6:49721180-49721202 TTTGTAACTGACCAGTTTGCTGG + Intergenic
1009349041 6:62651862-62651884 TTTGTTACTGACCAGTTTATAGG + Intergenic
1011341519 6:86320449-86320471 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1012200904 6:96404897-96404919 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1013080720 6:106809554-106809576 CTTATAACTGACCAGTCTGCTGG - Intergenic
1013473923 6:110489781-110489803 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1014200776 6:118606697-118606719 TTTGTTACTGACCAGCTTGCTGG + Intronic
1015377449 6:132526957-132526979 CATGTACCTGACCAGTTTGCCGG - Intergenic
1016854397 6:148652087-148652109 TTCATTACTGGCCAGCTTGCTGG - Intergenic
1018138037 6:160797097-160797119 TTTATAACTGACCAGTTTGCTGG - Intergenic
1018556017 6:165051337-165051359 TTTGTTACTGACCATTTTGTTGG - Intergenic
1018801834 6:167228650-167228672 TTTGTAACTGACCAGTCTGCTGG - Intergenic
1019076454 6:169392404-169392426 TTTGTTACTGACCAGTTTGCTGG + Intergenic
1019658247 7:2209444-2209466 CTTGTTTCTGACCAGTGTCCTGG - Intronic
1020847994 7:13311587-13311609 TTTGTAACTGACCAGCTTGCTGG - Intergenic
1025768816 7:64484088-64484110 TTTGTTACTAACCAGCTTGCTGG - Intergenic
1028389079 7:90294659-90294681 TTTGTAACTGACCAGTTTGCTGG + Intronic
1029811103 7:103050014-103050036 CACATAACTGACCAGTTTGCTGG + Intronic
1030156269 7:106459248-106459270 TTTGCAACTGACCAGTTTGCTGG + Intergenic
1031742941 7:125457025-125457047 TTTGTTACTGATCAGCTTGCTGG + Intergenic
1032088599 7:128897250-128897272 TTTGTAACTGACAAGTTTGCTGG - Intronic
1032671760 7:134090352-134090374 TTTGTAACTGACCAGTTTGTTGG + Intergenic
1033161732 7:139002791-139002813 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1033578094 7:142705287-142705309 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1039144075 8:34425878-34425900 CTCTTTGCTAACCATTTTGCAGG + Intergenic
1040089775 8:43386045-43386067 TTTGTAAATGACCAGTTTGCTGG + Intergenic
1040526274 8:48227849-48227871 TTCATTACTGACCATTTTGTTGG - Intergenic
1043012859 8:74901909-74901931 TTTGTTACTGATGAGTTTGCTGG - Intergenic
1043070421 8:75630018-75630040 TTTGTTACCGACCAGCTTGCTGG + Intergenic
1050401643 9:5262336-5262358 GACATGACTGACCAGTTTGCTGG + Intergenic
1050657838 9:7848458-7848480 TTTGTTACTGACCAGCTTGCAGG - Intronic
1053076137 9:35136430-35136452 AGTGTTACTGACCAGCTTGCTGG + Intergenic
1053082831 9:35191811-35191833 TTTGTTACTGACCATTTTGTTGG + Intronic
1056728209 9:89141251-89141273 GACATAACTGACCAGTTTGCTGG + Intronic
1057163395 9:92907364-92907386 TTTGTTACTGACCAGCTTGCTGG + Intergenic
1057580397 9:96282105-96282127 GACATAACTGACCAGTTTGCTGG - Intronic
1060681516 9:125569093-125569115 TTTGTTACTGACCAACTTGCTGG - Intronic
1187150107 X:16673314-16673336 TTTGTTATTGACCAGTTTGCTGG - Intronic
1187936901 X:24345068-24345090 TTTATAACTGACCAGTTTGCTGG + Intergenic
1188126317 X:26373683-26373705 TTTGTGACTGACCAGTTTTCTGG + Intergenic
1188133883 X:26470742-26470764 TTTGTAACTGACCAGTTTGCTGG + Intergenic
1188802617 X:34550377-34550399 CTTGCAACTGACTAGTTTGCTGG - Intergenic
1189086530 X:38031015-38031037 TTTGTAACTGACCAGTTTGCTGG + Intronic
1189632876 X:42974005-42974027 TTTGTTACTGACCATTTTACTGG + Intergenic
1189649985 X:43178345-43178367 TTTGCTACTGACCAGTTTGCTGG - Intergenic
1190815562 X:53925958-53925980 TTTGTTACTGACCAGCTTGCTGG - Intergenic
1190957125 X:55206920-55206942 CACGTTTGTGACCAGTCTGCTGG + Intronic
1190962731 X:55268284-55268306 GTAGTTACTGACCAGCTTTCTGG - Intronic
1191119455 X:56888335-56888357 TTTGTAACTGACAAGTTTGCTGG - Intergenic
1191640660 X:63427670-63427692 CAAGTTCCTGACCAGTTGGCTGG + Intergenic
1192534202 X:71913542-71913564 TCCCTTACTGACCATTTTGCTGG + Intergenic
1192864679 X:75118136-75118158 GACGTGACTGACCAGTTTGCTGG - Intronic
1194051873 X:89079276-89079298 TTTGTTACTGAACAGTTTTCTGG + Intergenic
1194086173 X:89531679-89531701 GACGTGACTGACCAGTTTGCTGG + Intergenic
1194138482 X:90177952-90177974 TTTGTCACTGACCAGCTTGCTGG + Intergenic
1194828393 X:98591646-98591668 TTTGTTACTGATCAGCTTGCTGG + Intergenic
1195559053 X:106262511-106262533 TTTGTTACTGACCAGCTTGCTGG + Intergenic
1196162272 X:112499172-112499194 TTTGTTACAGACCAGCTTGCTGG + Intergenic
1197065437 X:122227985-122228007 TTTGTTACTGACCAGATTGCAGG - Intergenic
1197509291 X:127350919-127350941 TTTGTTACTAACCTGTTTGCTGG - Intergenic
1198182034 X:134219664-134219686 TTTATAACTGACCAGTTTGCTGG + Intergenic
1198844790 X:140899391-140899413 TTTATAACTGACCAGTTTGCTGG + Intergenic
1199986673 X:152957676-152957698 TTTGTCACTGACCAGCTTGCTGG + Intronic
1200438832 Y:3187551-3187573 GACATGACTGACCAGTTTGCTGG + Intergenic
1200484279 Y:3748189-3748211 TTTGTCACTGACCAGCTTGCTGG + Intergenic
1201320994 Y:12698513-12698535 TTTGTTACTGACCACTTTGATGG + Intergenic