ID: 1094316967

View in Genome Browser
Species Human (GRCh38)
Location 12:29145765-29145787
Sequence CACGCTGCACAGATATTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094316967_1094316970 13 Left 1094316967 12:29145765-29145787 CCTAGTAATATCTGTGCAGCGTG 0: 1
1: 0
2: 0
3: 12
4: 98
Right 1094316970 12:29145801-29145823 AACATTATAAAAGAAGAGATAGG 0: 10
1: 21
2: 25
3: 95
4: 803

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094316967 Original CRISPR CACGCTGCACAGATATTACT AGG (reversed) Intergenic
909252631 1:73378533-73378555 AAGGCTGCACACATTTTACTTGG - Intergenic
909546390 1:76853113-76853135 CAAGCAGCACAAATATTGCTAGG + Intergenic
1076927107 10:133497041-133497063 CAGGCTGCACTGATATTTATTGG + Intergenic
1077520135 11:3028268-3028290 CAGGCTGCACTGATATTTATTGG - Intronic
1080842776 11:35999834-35999856 CACCCTGCCTGGATATTACTAGG - Intronic
1091267717 11:134283582-134283604 CACGCGGCACAGATCTTTCCAGG + Intronic
1091932451 12:4407044-4407066 CACGATGCACAAATATTAAGAGG - Intergenic
1094035531 12:26066333-26066355 CACTGTACACAGGTATTACTTGG - Intronic
1094316967 12:29145765-29145787 CACGCTGCACAGATATTACTAGG - Intergenic
1099030067 12:77515252-77515274 AACATTACACAGATATTACTGGG + Intergenic
1104878205 12:132051419-132051441 CAGGCTGCACTGATATTTATTGG + Intronic
1107990463 13:45814627-45814649 CACACTGCTCAGATCTTTCTGGG + Intronic
1110688338 13:78401770-78401792 CAAGCAGGACAGATTTTACTGGG + Intergenic
1111803846 13:93013610-93013632 GAAGCTGCAGAGATATTTCTGGG + Intergenic
1113775438 13:112942429-112942451 CAGGCTGCACTGATATTTATTGG - Intronic
1113880365 13:113622168-113622190 CAGGCTGCACTGATATTTATTGG - Intronic
1113916971 13:113880043-113880065 CACGCTCCACAAATATTACATGG + Intergenic
1114165738 14:20216640-20216662 CAGGCTGCACTGATATTTATTGG + Intergenic
1116774170 14:49160879-49160901 CACCTAGCACAGACATTACTGGG + Intergenic
1120443748 14:84567601-84567623 CAGACTACACAGATATTACTGGG - Intergenic
1123193207 14:106591395-106591417 CAGGCTGCGCTGATATTAATTGG + Intergenic
1129923305 15:79339293-79339315 CAGGCTGCACTGATATTTATTGG - Intronic
1134845634 16:17437586-17437608 CACCCTGCACAGCTATCACCTGG + Intronic
1136404095 16:30033464-30033486 CACGGAACACAGATTTTACTAGG - Intronic
1139633571 16:68245052-68245074 CACGCTGCGCAGCTCTCACTTGG - Intergenic
1142368880 16:89666688-89666710 CAGGCTGCACTGATATTTATTGG + Intronic
1142587469 17:982600-982622 CAGGCTGCACTGATATTTATTGG - Intergenic
1143278645 17:5733391-5733413 CTAGCTGCACAGGTATTACATGG + Intergenic
1145007425 17:19345477-19345499 CACTTTGCACAGATATGATTAGG + Intronic
1145223415 17:21107593-21107615 CAGGCTGCACTGATATTTATTGG + Intergenic
1146103857 17:30012600-30012622 CAGGCTGCACTGATATTTATTGG - Intronic
1146356052 17:32135217-32135239 CAGGCTGCACTGATATTTATTGG + Intergenic
1150559323 17:66281249-66281271 GATGCTGGACAGATTTTACTAGG - Intergenic
1152554331 17:81045536-81045558 CACGGTGCCCAGATATGACCAGG - Intronic
1153448368 18:5198046-5198068 CACACTGCACAGACATTATTAGG - Intergenic
1156473126 18:37389938-37389960 CACGCTGCACAGATCCTTCAGGG + Intronic
1161179735 19:2871830-2871852 CAGGCTGCACTGATATTTATTGG + Intronic
1163885152 19:19958851-19958873 CAGGCTGCACTGATATTTATTGG + Intergenic
1164389041 19:27801990-27802012 CAGGCTGCACTGATATTTATTGG + Intergenic
1166326898 19:42056606-42056628 CACTCTGCACAGATACTTCTGGG - Intronic
1166453718 19:42922783-42922805 CAGGCTGCACTGATATTTATTGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167979163 19:53258473-53258495 CAGGCTGCACTGATATTTATTGG - Exonic
930115762 2:47717025-47717047 CAGGCTGCACTGATATTTATTGG - Intronic
930154347 2:48090650-48090672 CACTTAGCACAAATATTACTAGG - Intergenic
930402713 2:50910898-50910920 AACTCTGCACAGATCTCACTGGG + Intronic
931823694 2:65977741-65977763 AACACTGCACAGATAATATTAGG - Intergenic
937888615 2:126917557-126917579 CTTGCTGCACAGCTGTTACTGGG - Intergenic
942095701 2:172534929-172534951 CAAACTACAGAGATATTACTGGG + Intergenic
943210922 2:184964605-184964627 CACGCTGTAAAGATACTACCAGG - Intergenic
943383634 2:187177626-187177648 CAAGCTGCAGAAATATTACTAGG - Intergenic
943527967 2:189041504-189041526 CGGGCTGCACAGACATTTCTTGG + Intronic
944146026 2:196508615-196508637 CATACTTCACAGATATTAGTGGG - Intronic
948978754 2:241481672-241481694 GACCCTGCACAGAGGTTACTAGG - Intronic
949019304 2:241732229-241732251 CAGGCTGCACTGATATTTATTGG + Intergenic
1173370473 20:42430176-42430198 CACGGTCCACAGATATAACTGGG + Intronic
1177262913 21:18752305-18752327 CATGCTGGCCGGATATTACTAGG + Intergenic
1178480481 21:32975809-32975831 CACACTGCACAGACCTTACTGGG - Intergenic
1180639336 22:17285796-17285818 CACACTGAACAGAAAGTACTGGG - Intergenic
1180864453 22:19108117-19108139 CACGAAGCTCAGATTTTACTAGG + Intronic
1182335311 22:29580210-29580232 GACCCTGCACAGTTATGACTTGG - Intronic
1183280860 22:36931642-36931664 AAAGCTGCACAGCTATTAGTAGG + Intronic
1184524421 22:45013381-45013403 CAAGCTGCACAGCTATAAATGGG + Intergenic
1184607557 22:45582732-45582754 CACTCTGCACAGTTGTTTCTGGG + Intronic
949381627 3:3453080-3453102 CACCCTTAACAGTTATTACTGGG + Intergenic
949619041 3:5789400-5789422 AACTCTGCAGAGATGTTACTTGG - Intergenic
951604602 3:24419221-24419243 CAAGCTGCAGAGATAGTACAGGG - Intronic
952903870 3:38127015-38127037 AACCCAGCACAGATATTTCTGGG - Intronic
955467503 3:59252371-59252393 CACCCTGCAAAGATATTTCCAGG - Intergenic
957228272 3:77476803-77476825 CACACTGCCCAGATGTCACTCGG + Intronic
958657248 3:97018413-97018435 CAGGCTGCACTGATATTTATTGG + Intronic
960269808 3:115661352-115661374 CAAGCTGCTAAGATATAACTGGG + Intronic
963251167 3:143104751-143104773 CATATTGCAGAGATATTACTAGG + Intergenic
966815599 3:183887340-183887362 CAGGCTGCACTGATATTTATTGG - Intergenic
974296107 4:60000467-60000489 CAAACTACAGAGATATTACTGGG - Intergenic
974493435 4:62595954-62595976 CAGGCTGCACTGATATTTATTGG - Intergenic
975378409 4:73671026-73671048 CAGGCTGCACTGATATTTATTGG + Intergenic
977246068 4:94632898-94632920 TAACCTACACAGATATTACTGGG - Intronic
981153843 4:141411136-141411158 CACTCAGAACAGATATTACCAGG - Intergenic
982607026 4:157528181-157528203 CAAGCTACAGAGATATTAGTGGG - Intergenic
986162798 5:5246400-5246422 CACCATCCACAGATATTTCTAGG + Intronic
986355008 5:6915373-6915395 CCCACTGCACAAAGATTACTAGG + Intergenic
988871098 5:35390984-35391006 CAAGCTGCACATATTTTTCTTGG + Intergenic
995538762 5:113163914-113163936 CACACTACACAGAGATTACCTGG - Intronic
1003637417 6:7845403-7845425 CACCCTGCACAGACATAGCTGGG - Intronic
1010104293 6:72149229-72149251 CAAACTACACAGATATTACTGGG - Intronic
1014082304 6:117301914-117301936 AGTGCTGCACAGATATTTCTTGG - Intronic
1014118554 6:117695433-117695455 CTCTCTGCTCAGATGTTACTGGG + Intronic
1016206335 6:141472495-141472517 CAAACTGCAGAGATATTACTAGG - Intergenic
1019109389 6:169697807-169697829 CAGGCTGCACTGATATTTATTGG - Intronic
1020596553 7:10213789-10213811 CAAACTGCGGAGATATTACTAGG - Intergenic
1023074349 7:36468148-36468170 CAGGCTGCACTGATATTTATTGG - Intergenic
1024088851 7:45919607-45919629 CACGTTGGACAGATGTCACTGGG - Intronic
1029277411 7:99415194-99415216 CAGGCTGCACTGATATTTATTGG + Intronic
1029699635 7:102237801-102237823 CAGGCTGCACTGATATTTATTGG + Intronic
1031785445 7:126025616-126025638 TCCACTGCATAGATATTACTAGG - Intergenic
1040104976 8:43536395-43536417 CAGGCTGCACTGATATTTATTGG + Intergenic
1044129710 8:88506143-88506165 CAGCCTGCCCAGAGATTACTTGG - Intergenic
1047614713 8:126555022-126555044 CAGGCTGAGCAGATACTACTTGG - Exonic
1049458705 8:142709932-142709954 CAGGCTGCACTGATATTTATTGG + Intergenic
1049666269 8:143844645-143844667 CAGGCTGCACTGATATTTATTGG - Intergenic
1049880076 8:145055936-145055958 CAGGCTGCACTGATATTTATTGG - Exonic
1058159185 9:101549190-101549212 CAGGCTGCACTGATATTTATTGG + Intronic
1062557251 9:137119380-137119402 CAGGCTGCACTGATATTTATTGG - Intergenic
1062571400 9:137187330-137187352 CACGCTGCACAGGAATCCCTGGG + Intronic
1062645534 9:137546325-137546347 CAGGCTGCACTGATATTTATTGG - Intronic
1189051041 X:37645883-37645905 CAAGGTGCACACACATTACTTGG - Intronic
1194227562 X:91279882-91279904 GAAACTGCAGAGATATTACTAGG - Intergenic
1197495446 X:127173773-127173795 CAAACTGCAGAGATATTACTAGG - Intergenic
1198287576 X:135207141-135207163 CAGGCTGCACTGATATTTATTGG - Intergenic
1198344666 X:135747736-135747758 CAGGCTGCACTGATATTTCTTGG + Intergenic