ID: 1094317466

View in Genome Browser
Species Human (GRCh38)
Location 12:29149359-29149381
Sequence GGATTTAGAGGACCACTAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094317455_1094317466 25 Left 1094317455 12:29149311-29149333 CCGTTTCCTTGTGGCTGGAGCGC 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1094317466 12:29149359-29149381 GGATTTAGAGGACCACTAGTTGG 0: 1
1: 0
2: 0
3: 2
4: 42
1094317461_1094317466 0 Left 1094317461 12:29149336-29149358 CCCGTAGCCTCGGGGAAGGAGCA 0: 1
1: 0
2: 2
3: 20
4: 172
Right 1094317466 12:29149359-29149381 GGATTTAGAGGACCACTAGTTGG 0: 1
1: 0
2: 0
3: 2
4: 42
1094317462_1094317466 -1 Left 1094317462 12:29149337-29149359 CCGTAGCCTCGGGGAAGGAGCAG 0: 1
1: 0
2: 0
3: 12
4: 207
Right 1094317466 12:29149359-29149381 GGATTTAGAGGACCACTAGTTGG 0: 1
1: 0
2: 0
3: 2
4: 42
1094317456_1094317466 19 Left 1094317456 12:29149317-29149339 CCTTGTGGCTGGAGCGCTTCCCG 0: 1
1: 0
2: 1
3: 13
4: 105
Right 1094317466 12:29149359-29149381 GGATTTAGAGGACCACTAGTTGG 0: 1
1: 0
2: 0
3: 2
4: 42
1094317464_1094317466 -7 Left 1094317464 12:29149343-29149365 CCTCGGGGAAGGAGCAGGATTTA 0: 1
1: 0
2: 2
3: 19
4: 143
Right 1094317466 12:29149359-29149381 GGATTTAGAGGACCACTAGTTGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094317466 Original CRISPR GGATTTAGAGGACCACTAGT TGG Exonic
910949072 1:92625793-92625815 GGATTTAGAGGAACACTGGCAGG - Exonic
923251507 1:232183051-232183073 AGATTCAGATGACCACTAGAAGG + Intergenic
1064949622 10:20833884-20833906 GGATTTAGACCACCACTATGGGG + Intronic
1065285323 10:24181997-24182019 GAATTTAGATGAGCACGAGTGGG + Intronic
1071755516 10:88534320-88534342 GGATTTATATGACCAGTATTAGG - Intronic
1093280567 12:17190512-17190534 AGATTTAGAGAACCAGTATTTGG - Intergenic
1094317466 12:29149359-29149381 GGATTTAGAGGACCACTAGTTGG + Exonic
1105408842 13:20152802-20152824 GGATTTTGAGGGTCACAAGTAGG + Intronic
1111518411 13:89365030-89365052 GGGTTCAAAGCACCACTAGTAGG + Intergenic
1116147755 14:41097980-41098002 GACTTTAGAGGAACACTAGGAGG - Intergenic
1118153329 14:63213294-63213316 AGATACTGAGGACCACTAGTTGG - Intronic
1120177549 14:81311104-81311126 GGACTTAGATGACCACTTCTTGG + Intronic
1121212928 14:92222481-92222503 GGGGTAAGGGGACCACTAGTGGG + Intergenic
1127037851 15:54938837-54938859 GGTTTTAAAGGACCAATTGTGGG + Intergenic
1127424279 15:58839672-58839694 GTGTTTAAAGGACCACTAGGTGG + Intronic
1140799621 16:78473777-78473799 GCATTCAGGGGACCACTGGTGGG - Intronic
1153080097 18:1212708-1212730 GGAGGTAAAGGACCACTAGAAGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162604667 19:11697423-11697445 GGATTTAGAGAGCCACAGGTGGG + Intergenic
1163255774 19:16154931-16154953 GGATTTTGAGGAACACTTTTGGG - Intronic
934992237 2:98930041-98930063 GGATTCAGAGGACCAGCATTGGG - Intronic
936064493 2:109320109-109320131 GGCTTTACAGGAGCACTAGTAGG - Intronic
936724754 2:115299974-115299996 GAATTTATAGGACCACTTGAAGG - Intronic
938552701 2:132395602-132395624 GGATGTTCAGGAGCACTAGTGGG - Intergenic
1179181780 21:39051446-39051468 GAATTTAGAGAAACACTTGTTGG + Intergenic
1181830022 22:25553106-25553128 GGAATTAGAGGACGCCCAGTTGG - Intergenic
975162445 4:71139342-71139364 GGATGAAGAGGACCAGGAGTGGG - Intergenic
975962444 4:79929148-79929170 GGAAATAGATGACCACTACTGGG + Intronic
983089233 4:163484982-163485004 GGATTTGGACGACCACCAGATGG + Intergenic
989472776 5:41839750-41839772 GGCTTTATAGGACCCCTATTGGG - Intronic
990866668 5:60387798-60387820 TGAATTAGAGGACCCCCAGTTGG - Intronic
991338154 5:65573976-65573998 GGATTCAGAGAACCACTTGATGG - Intronic
993191080 5:84682443-84682465 GGAGTTTGGAGACCACTAGTTGG - Intergenic
999631892 5:153580016-153580038 GGAAACAGAGGACCACAAGTAGG + Intronic
1007410574 6:41658946-41658968 GGATTTATGGGACCATTAGGGGG + Intergenic
1022773016 7:33494624-33494646 TAATTTATAGGACCACTACTTGG - Intronic
1023405245 7:39826786-39826808 TGATTTAGAGGACCCCCAGCTGG + Intergenic
1034874882 7:154716384-154716406 GCATTTAGGGGACTACAAGTAGG - Intronic
1038770134 8:30470548-30470570 GGATTTAAGTGACCTCTAGTTGG + Intronic
1041238470 8:55828330-55828352 GGATTTAAAGGAACACAAATAGG - Intergenic
1042441579 8:68833171-68833193 GGATTAAGAGGAGCATTATTTGG + Intergenic
1051421652 9:16894756-16894778 GGTTTTAGAGGATGACCAGTGGG - Intergenic
1057230187 9:93317239-93317261 GGACTTGGAGGAGGACTAGTGGG - Intronic
1186126690 X:6422146-6422168 GGAGTTAGAGGAGCCCTAGGTGG + Intergenic
1189579975 X:42395946-42395968 GGATTTAGAGGAATATTATTTGG + Intergenic