ID: 1094319669

View in Genome Browser
Species Human (GRCh38)
Location 12:29171403-29171425
Sequence TCCCAGATGGGGCAGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8588
Summary {0: 6, 1: 34, 2: 291, 3: 1900, 4: 6357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094319669_1094319676 15 Left 1094319669 12:29171403-29171425 CCCGGCTGCTGCCCCATCTGGGA 0: 6
1: 34
2: 291
3: 1900
4: 6357
Right 1094319676 12:29171441-29171463 TGCCCAGCTGCCACCCCATCTGG 0: 10
1: 112
2: 692
3: 2679
4: 3840
1094319669_1094319677 16 Left 1094319669 12:29171403-29171425 CCCGGCTGCTGCCCCATCTGGGA 0: 6
1: 34
2: 291
3: 1900
4: 6357
Right 1094319677 12:29171442-29171464 GCCCAGCTGCCACCCCATCTGGG 0: 14
1: 172
2: 1182
3: 3855
4: 4930
1094319669_1094319680 24 Left 1094319669 12:29171403-29171425 CCCGGCTGCTGCCCCATCTGGGA 0: 6
1: 34
2: 291
3: 1900
4: 6357
Right 1094319680 12:29171450-29171472 GCCACCCCATCTGGGATGTGAGG 0: 44
1: 1100
2: 3964
3: 6687
4: 11061

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094319669 Original CRISPR TCCCAGATGGGGCAGCAGCC GGG (reversed) Intronic
Too many off-targets to display for this crispr