ID: 1094319853

View in Genome Browser
Species Human (GRCh38)
Location 12:29172234-29172256
Sequence TCCCAGATGGGGCAGCGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4445
Summary {0: 1, 1: 5, 2: 66, 3: 607, 4: 3766}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094319853 Original CRISPR TCCCAGATGGGGCAGCGACC AGG (reversed) Intronic
Too many off-targets to display for this crispr