ID: 1094320774

View in Genome Browser
Species Human (GRCh38)
Location 12:29180460-29180482
Sequence CTAAACATGAAGGATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094320774_1094320779 9 Left 1094320774 12:29180460-29180482 CCATCCACATCCTTCATGTTTAG 0: 1
1: 0
2: 0
3: 15
4: 203
Right 1094320779 12:29180492-29180514 TTAATTTGTCCATTCACTTGTGG 0: 1
1: 0
2: 1
3: 33
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094320774 Original CRISPR CTAAACATGAAGGATGTGGA TGG (reversed) Intronic
902053801 1:13584021-13584043 CTCAACGGGAACGATGTGGAAGG + Exonic
904549227 1:31301345-31301367 CAAAATATGAATGATGGGGATGG - Intronic
904764219 1:32830530-32830552 CACAACTTGAAGGATCTGGAAGG - Intronic
906611323 1:47205701-47205723 CTAAGCAGGAAGGCTGTGGGAGG - Intergenic
911878855 1:103207312-103207334 GTAAAAATTAAGGATGTGGGAGG + Intergenic
914998755 1:152567375-152567397 CTAAACATAAAGCAGGAGGAAGG - Intronic
917308037 1:173647568-173647590 GTAAACAAGAAGAATATGGAAGG + Intronic
918144946 1:181747366-181747388 TTACACATGAAAGATCTGGAGGG + Intronic
919593666 1:199535521-199535543 TTAAACATAAAGGAAGTAGAAGG + Intergenic
920991074 1:210940604-210940626 ATAAACAGAAAGGAAGTGGATGG - Intronic
921223342 1:212991600-212991622 CTAAATATGTAAGATGTGGCCGG + Intronic
922176460 1:223201623-223201645 AGAAACATGAAGGATGAGCATGG - Intergenic
923266863 1:232322931-232322953 CTTAACACTGAGGATGTGGAAGG + Intergenic
1063273425 10:4537508-4537530 CTCAACATGAAGTGTTTGGAAGG - Intergenic
1065621249 10:27584460-27584482 CTAAACATGAGGGTTGTAAAGGG + Intergenic
1065773247 10:29096879-29096901 GTAGACAAGAAGGATGGGGATGG - Intergenic
1065952734 10:30666759-30666781 CTAAAAAAGGAGGGTGTGGAGGG - Intergenic
1069234438 10:66052388-66052410 CTTGAAATGAAGGATGGGGAAGG + Intronic
1070354949 10:75630969-75630991 CCAAACATGAGGGACGAGGAGGG - Intronic
1071227721 10:83550366-83550388 CTAAAAAAGAATGATGTGGGAGG - Intergenic
1074174013 10:110977533-110977555 CTAAACATGCAGGATGGGTACGG - Intronic
1076810431 10:132883763-132883785 CTAAACGGGAATGATGGGGATGG + Intronic
1078409343 11:11099063-11099085 CTAGTCATGAAGGATCTTGAAGG - Intergenic
1079775849 11:24525857-24525879 TTAAACAGGAAGGAAGTGGTTGG + Intronic
1080277357 11:30517616-30517638 AGAAACATGCAGGATGAGGAAGG - Intronic
1081746255 11:45474433-45474455 CTACACATGAAGGGGATGGAGGG - Intergenic
1083701321 11:64479751-64479773 ATCAAAATGAAAGATGTGGATGG - Intergenic
1088409851 11:109522348-109522370 CTATACAAGCAGGCTGTGGATGG + Intergenic
1091164362 11:133459726-133459748 GTAAACATGAAAGAATTGGAAGG + Intronic
1093168026 12:15828242-15828264 TTAAGCATGAAGGATGGAGATGG + Intronic
1094221219 12:27995664-27995686 TTAAACAAGAAGGAAGAGGAGGG - Intergenic
1094320774 12:29180460-29180482 CTAAACATGAAGGATGTGGATGG - Intronic
1094320963 12:29182750-29182772 CTCAACATCAAGGATGTAGATGG + Intronic
1094323760 12:29213800-29213822 CAAAGCATGAAGGATGGAGATGG - Intronic
1098074054 12:66707661-66707683 ATATGCAGGAAGGATGTGGAGGG - Intronic
1098872109 12:75827602-75827624 AAAAACACTAAGGATGTGGAAGG + Intergenic
1099424859 12:82511032-82511054 CTAAAGATGAAGGAGGAAGATGG - Intergenic
1100375473 12:94012169-94012191 CTAAATTTGAAGAATGTTGAGGG - Intergenic
1101055565 12:100909104-100909126 TTAAATTTGAAGAATGTGGATGG + Intronic
1102058526 12:109914800-109914822 CACGACATGGAGGATGTGGAGGG - Intronic
1104975957 12:132552086-132552108 CAGAACATGGAGGCTGTGGATGG - Intronic
1107907111 13:45071467-45071489 CCAAAGATGAAGGTTGTGGCCGG + Intergenic
1108787296 13:53920669-53920691 ATATACCTGAAGGAGGTGGACGG - Intergenic
1108837343 13:54568133-54568155 CTAAACATAAAGGATGCATAGGG + Intergenic
1109956036 13:69567579-69567601 CTACACATGGAGGAGGTGGTTGG - Intergenic
1112295266 13:98180588-98180610 CTGAAACTGAAGGCTGTGGAGGG - Intronic
1113014950 13:105818209-105818231 CTAAACAAGACGGAGGTGGCAGG + Intergenic
1114765297 14:25364051-25364073 CTAAATATGAAGGAATTGAAAGG + Intergenic
1114999153 14:28401018-28401040 CTCACCACTAAGGATGTGGAAGG + Intergenic
1115747219 14:36449980-36450002 GTCACCATGAAGGACGTGGAAGG - Intergenic
1117563570 14:56970148-56970170 GAAAACATGAAGTATGTGAAGGG + Intergenic
1117914710 14:60665101-60665123 CAAAACAAGAAAGATGTGCATGG + Intergenic
1117943289 14:60991814-60991836 CTAGACCTCAAGGATGGGGAAGG - Intronic
1118044104 14:61948007-61948029 CTAAGCATAAAGTATCTGGAAGG + Intergenic
1119254050 14:73183073-73183095 CTAAAGTTGAAGTATTTGGAGGG + Intronic
1120738505 14:88081879-88081901 ATAAACATCTAGGATGTAGAAGG + Intergenic
1120825512 14:88951251-88951273 CTACACAGAATGGATGTGGATGG - Intergenic
1123660416 15:22559911-22559933 CTGCTCATGAAGGTTGTGGAAGG + Intergenic
1126692500 15:51298662-51298684 CTAAACATGATTGATGGGCATGG - Intronic
1128412623 15:67414526-67414548 CTCAACATGACAGATGAGGAAGG - Intronic
1129654407 15:77514485-77514507 CTGTACATGTAAGATGTGGATGG + Intergenic
1131864658 15:96694767-96694789 CTAAACATGCAGGTGGTTGAGGG + Intergenic
1133180368 16:4049664-4049686 GTGGACATGAAGGATGCGGAAGG - Intronic
1134412661 16:14015967-14015989 TTAAACATGAAGGATTGTGAAGG - Intergenic
1135129892 16:19844715-19844737 CCAAACATGAAGAAAGAGGATGG - Intronic
1135129900 16:19844773-19844795 CCAAACATGAAGAAAGGGGATGG + Intronic
1135818333 16:25656396-25656418 CAAAAGATGAAGGATGGTGATGG + Intergenic
1137515650 16:49141131-49141153 CTGAACAAGAAGGATGTTGTGGG - Intergenic
1137691757 16:50433075-50433097 CTAAACCTGAAAGATGTAAAAGG - Intergenic
1139638784 16:68275720-68275742 GTAAGCATAAAGGATGGGGATGG + Intronic
1139952563 16:70679322-70679344 CTCTACAGGAAGGATGTGGGAGG + Exonic
1140560715 16:75977609-75977631 TTAAACATGAAGGGTGATGACGG + Intergenic
1140633814 16:76887382-76887404 TTAAACATCAAGGATGTGGTAGG + Intergenic
1141120131 16:81347462-81347484 CCAAACAGGAAGGAAGTGAAAGG - Intronic
1141341472 16:83207947-83207969 TAAAAGATGAAGGATCTGGATGG + Intronic
1142138046 16:88460553-88460575 CTAAACATGAAGGCTGGTGTTGG - Intronic
1145407702 17:22620506-22620528 CTAATCATAAAGAATATGGAGGG + Intergenic
1145756629 17:27396525-27396547 CCACACATGATGGATGCGGAAGG - Intergenic
1147276872 17:39325255-39325277 CTCAAAATGAAGGATGAGAATGG + Intronic
1150983707 17:70171269-70171291 ATAAACATGAGGGAGGAGGAGGG - Intronic
1151617735 17:75225288-75225310 CTAAATATAAAGGGTGTGGATGG + Intronic
1152169148 17:78732250-78732272 TTAGACAGGAGGGATGTGGAAGG - Intronic
1155531190 18:26768413-26768435 ATACACAGGAAGGATGTGCAGGG - Intergenic
1155557859 18:27041572-27041594 TTAAACATCAAATATGTGGAGGG + Intronic
1155929065 18:31686167-31686189 CTAATCATGCAGGAAGTGGCGGG + Intergenic
1158005743 18:52670288-52670310 GAATACAGGAAGGATGTGGATGG + Intronic
1158366964 18:56747183-56747205 CAAAACATGGAGGAAGTGGTGGG + Intronic
1159138862 18:64369062-64369084 CTCACCACTAAGGATGTGGAAGG + Intergenic
1159617290 18:70596198-70596220 GTAAACATTAAGGATGTTTAAGG + Intergenic
1163042704 19:14614371-14614393 ATAATCATGAGAGATGTGGAAGG - Intergenic
1163931460 19:20397155-20397177 CTACACAGGAAGGCTGTGGCAGG + Intergenic
1164843369 19:31411506-31411528 CAAAATATGAGGCATGTGGATGG + Intergenic
1166427806 19:42695251-42695273 CTAAATATGATGGATGGAGAAGG + Intronic
1166480860 19:43172581-43172603 CTAAACATGAACAATCTGAAGGG + Intronic
1167687050 19:50962990-50963012 CTAATCAGGAAGGATGTCAAAGG - Intronic
926715753 2:15922243-15922265 CAAAAGAGGAAGGAAGTGGACGG + Intergenic
928049060 2:27969509-27969531 CTAAGAATGAAGGATGAGGGTGG - Intronic
929984956 2:46720203-46720225 CTGAACAGCAAGGATGTGCAAGG - Intronic
930286771 2:49439699-49439721 CTTAACATAAAGTATGTGGTAGG - Intergenic
930570149 2:53076336-53076358 CTAATAATTAAGGATGAGGATGG - Intergenic
932583425 2:73007417-73007439 TGAAACCTGAAGGATGAGGAGGG - Intronic
933689118 2:85165912-85165934 CAAAACATGAAGAATGGTGAGGG - Intronic
934583142 2:95463446-95463468 CTAAGCTTGAAGGAAGAGGATGG + Intergenic
934596308 2:95613268-95613290 CTAAGCTTGAAGGAAGAGGATGG - Intergenic
934879340 2:97960344-97960366 TTAAACATGAAGAAGGTGGATGG - Intronic
935222294 2:101026063-101026085 TGAAACATGAACGATGTGGCTGG + Intronic
936018846 2:108979664-108979686 TTAATCATGAAGGATGCAGATGG + Intronic
937260914 2:120586453-120586475 GGAAACCTGAAGGATGAGGAGGG - Intergenic
937996476 2:127698303-127698325 CTCAAAATGAAGGATCGGGAGGG + Intergenic
938370790 2:130767215-130767237 CTAATCTTGGAGAATGTGGATGG - Exonic
938381412 2:130838267-130838289 CTAACCCTGAAAGGTGTGGAGGG - Intronic
939525551 2:143289401-143289423 TTAAAAATGAAGGATGTAAAAGG + Intronic
939716575 2:145591347-145591369 TTAAGCATTAAGGATGAGGAAGG - Intergenic
939733230 2:145811185-145811207 CTCAAAATGAAGGATGCGAAAGG - Intergenic
939999491 2:148952567-148952589 CTAAACATGTAGGATGTCCTAGG + Intronic
940502898 2:154516626-154516648 CTAAATATGAAGAAGGTGGGTGG - Intergenic
940741077 2:157508323-157508345 CTTAACATGAAGTATATGGATGG + Intergenic
941514116 2:166450503-166450525 CTAAAAGTTCAGGATGTGGACGG + Intronic
942388695 2:175468910-175468932 CTACAGATGAGGGCTGTGGATGG - Intergenic
942906928 2:181194222-181194244 GTGAACATGAAGGATGTTTAAGG + Intergenic
944708195 2:202311931-202311953 CAAAGCTTAAAGGATGTGGAAGG - Intergenic
944969019 2:204970143-204970165 CTAATCATGAAGGCAGTGTAGGG - Intronic
946520120 2:220455487-220455509 ACAAACATGAAGCATCTGGATGG - Intergenic
947704321 2:232262152-232262174 CTTAACATGAAGGAGGTGTTAGG + Intronic
1172856716 20:38009850-38009872 CAAAACCTGAAGGATGAGAAAGG - Intronic
1173043917 20:39491413-39491435 CGAGAAATGAAGGATGAGGATGG + Intergenic
1174819646 20:53715418-53715440 CTAGACAAGGAGTATGTGGAAGG + Intergenic
1175144853 20:56887816-56887838 CTAAACATGAGTGAAGTGCAGGG + Intergenic
1175583322 20:60117412-60117434 CTAAACATGAAGAAGATGAACGG + Intergenic
1175596649 20:60239892-60239914 CTAACAATGAAGGATGTGGCAGG + Intergenic
1177922643 21:27171726-27171748 CTTAAAATGAAGGGTGGGGAAGG - Intergenic
1178117996 21:29436933-29436955 TTGAAGATGAAGGATGTGTATGG - Intronic
1178511574 21:33209565-33209587 GAAAATATGAAGGATGAGGAGGG + Intergenic
1181746350 22:24957424-24957446 CTAAACCTGAAGGCTTTGGCAGG + Intronic
1181976974 22:26737084-26737106 CTAAGCATGAAAGATATGAATGG - Intergenic
949664734 3:6324113-6324135 CTGAACATGTAGTATGTGCAAGG + Intergenic
953049546 3:39328232-39328254 CAAAACATGAATGATGGTGAGGG + Intergenic
955233622 3:57121217-57121239 CTCAACAAGAAGGATGTTGGAGG + Intronic
958021189 3:87998189-87998211 CTTAACATCAAGGAGGTAGAGGG - Intergenic
958552350 3:95632540-95632562 GAAAATATGAATGATGTGGAAGG + Intergenic
958552657 3:95636949-95636971 ATCAAAATGAAGGATGTTGAAGG + Intergenic
958828997 3:99065537-99065559 CTCAACATTAGGGTTGTGGAAGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964256055 3:154775483-154775505 CTCAGCAAGAAGGATGTGTATGG + Intergenic
964851126 3:161097264-161097286 CTAAACATCTAGGATGGGGCTGG + Intronic
965418354 3:168425815-168425837 GAAAACATCAAGGATGTGGCTGG + Intergenic
965567776 3:170138871-170138893 CTCCAAATGAAGGAAGTGGAAGG - Intronic
966549193 3:181184976-181184998 CAAAGCACAAAGGATGTGGAAGG + Intergenic
966710248 3:182965087-182965109 ATAAACATAAAAGATATGGAAGG + Intronic
970872529 4:20832746-20832768 CTCAGCATGAAGGATTTGGTAGG + Intronic
971047128 4:22817461-22817483 CTTAACATGGAGTCTGTGGATGG + Intergenic
972711928 4:41605960-41605982 CTAAACCTGAAGGAGTTTGAAGG + Exonic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
977502009 4:97852453-97852475 CTCACCATGAAGTATGTGGAAGG + Intronic
978758629 4:112331026-112331048 CTAAACCTGAGGGATGAGGAGGG - Intronic
981673852 4:147318489-147318511 CTAAAAGTAAAGGATTTGGAGGG - Intergenic
983048305 4:163012692-163012714 GTAATCATTAAAGATGTGGATGG - Intergenic
985277023 4:188246947-188246969 CTAAACTTGAAGAATGATGATGG + Intergenic
992171036 5:74102276-74102298 CTACTCATGAAGGAAGGGGAGGG - Intergenic
992868870 5:80985746-80985768 CAGCACAGGAAGGATGTGGAGGG + Intronic
994358757 5:98826018-98826040 CTATACAGGAAAGATGTGGCAGG + Intergenic
995920513 5:117305420-117305442 CTAGACATAAAGGTTGTGCAAGG - Intergenic
997400326 5:133597096-133597118 CTAGACATGGAGGATGTGGGAGG - Intronic
998469714 5:142374339-142374361 CCAATCCTGAAGGATGTGGTGGG - Intergenic
999850746 5:155536054-155536076 GTAAACCTGGAGGCTGTGGAAGG + Intergenic
1001626271 5:173137235-173137257 TTAAAGATGTAGGAAGTGGAAGG - Exonic
1001646692 5:173287353-173287375 CAAAGCATAAAGGAGGTGGAGGG + Intergenic
1001903520 5:175451789-175451811 CTAAAAGTGAAGGATTTAGATGG - Intergenic
1002024276 5:176386321-176386343 CTAAAGATAAAGGATTTGAATGG - Intronic
1003433107 6:6058375-6058397 TTGAACATGAAGGATTGGGAAGG - Intergenic
1005211065 6:23464289-23464311 CAAAACATGAAGGATTTTTAGGG + Intergenic
1007825464 6:44596497-44596519 TTAACCATAAAGGATGTGGCTGG - Intergenic
1011723116 6:90179444-90179466 CTTAACTTGATGGATTTGGAAGG + Intronic
1012272211 6:97227396-97227418 CAAAACAAGAAGGAAGAGGAGGG - Intronic
1013546602 6:111164134-111164156 ATAAAGTTGAAGGTTGTGGAAGG - Intronic
1014015001 6:116519571-116519593 CTAGACTTGAAGCATATGGAAGG + Exonic
1014630323 6:123781556-123781578 CTAAAAATCAAGGGTGTAGAAGG - Intergenic
1015258507 6:131207629-131207651 CTAAAGATGTAGTATGTGGCTGG - Intronic
1015455875 6:133425534-133425556 CAAAACAGGAAGAAAGTGGAGGG - Intronic
1017091940 6:150766961-150766983 GTAAAACAGAAGGATGTGGATGG - Intronic
1017179153 6:151533710-151533732 CTTCAGATGAAGGAGGTGGAAGG - Intronic
1020146842 7:5650939-5650961 TTAAATATGAAGGATATGGAAGG - Intronic
1021948328 7:25750329-25750351 CTAATAATGAAGGAAATGGATGG + Intergenic
1022694414 7:32690211-32690233 TGAAAGATGAGGGATGTGGAGGG - Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023596833 7:41838351-41838373 CTAATAATTAAGGATGTTGAGGG + Intergenic
1026793170 7:73348417-73348439 CTATACAGGGAGGATGTGGACGG - Intronic
1028107640 7:86899054-86899076 CTGAAGATGATGGATGTGGATGG + Intronic
1029009892 7:97248580-97248602 TTAGACATGAAGGATCAGGAGGG - Intergenic
1029480201 7:100807638-100807660 CTAAAAAAAAAAGATGTGGATGG - Intronic
1031284732 7:119852161-119852183 CTAAAAATGAAGAATCTGGAAGG - Intergenic
1032697242 7:134347925-134347947 TAAAACATGAAGGAGTTGGAAGG + Intergenic
1035188778 7:157146982-157147004 CTAAAGAAGAAGGAAGTCGAAGG - Intronic
1037603954 8:20422025-20422047 CTAGAAATGAAGGGTGTGGATGG - Intergenic
1037866148 8:22444092-22444114 CTTAAATTGAAGGATGTGGCTGG + Intronic
1044710808 8:95055921-95055943 CTAAAAATGAAGGCAGTGGCAGG - Intronic
1046758457 8:117995497-117995519 CTGAAAATGAAGGACGTGGTTGG + Intronic
1047653275 8:126947759-126947781 CTTTTCCTGAAGGATGTGGAGGG + Intergenic
1048207746 8:132429106-132429128 CAAAACATGAATGCTGGGGAAGG - Intronic
1048335541 8:133499578-133499600 CAAACCCTGAAGGATGAGGATGG + Intronic
1051983161 9:23048186-23048208 CTAAACATAGAGGAGATGGATGG + Intergenic
1057320920 9:94011757-94011779 TCAATCATGAAGGATGAGGAAGG + Intergenic
1058196670 9:101985341-101985363 CTAAACATAAAGAAGGTAGAAGG + Intergenic
1058377155 9:104336038-104336060 CTAAACTTGAAGAAAGAGGAAGG + Intergenic
1061212407 9:129201507-129201529 CCAAAGATGATGGATGTGTAGGG - Intergenic
1061224996 9:129276315-129276337 CTACTCAAGAAGGATGAGGAGGG - Intergenic
1203654103 Un_KI270752v1:7165-7187 CTAAACATTAAAGATTTTGAAGG + Intergenic
1186149252 X:6656585-6656607 CATAGCATAAAGGATGTGGAGGG + Intergenic
1188711322 X:33403868-33403890 AAAAACTTTAAGGATGTGGAGGG - Intergenic
1190302561 X:49065167-49065189 CTGATCATGCAGGATGTGGTCGG - Intronic
1192031884 X:67522801-67522823 TTAAAAATGAAAGCTGTGGAAGG + Intergenic
1192549206 X:72040534-72040556 CTAAACGAGAATGATGTGGGTGG + Intergenic
1193261526 X:79412188-79412210 ATTCACATGAAGGATGTGGTAGG - Intergenic
1195515543 X:105771473-105771495 ATATACATGAAGGAAGTGGGGGG + Intergenic
1196211288 X:112998418-112998440 CTAAAGATTAGGGTTGTGGAGGG + Intergenic
1196892835 X:120307590-120307612 TTAATCAAGAAGGATGTGGGAGG + Intronic
1197180149 X:123526343-123526365 TTAAACATGAAAGAAGTAGAGGG - Intergenic
1197779463 X:130145208-130145230 GAAAACAGGAAGGATGAGGAAGG + Intronic
1201613260 Y:15866640-15866662 CTCAAAATGCAGTATGTGGATGG + Intergenic