ID: 1094321599

View in Genome Browser
Species Human (GRCh38)
Location 12:29189988-29190010
Sequence GAGGGGAAATAGAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 802
Summary {0: 1, 1: 1, 2: 2, 3: 81, 4: 717}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094321599 Original CRISPR GAGGGGAAATAGAAGGATGA AGG Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900204717 1:1427059-1427081 GGGGGGAGATGGAGGGATGAAGG - Intronic
900784033 1:4636501-4636523 GAGGAGAAAAAGAAAGATGACGG + Intergenic
900912945 1:5615023-5615045 CAGGGAATATAGCAGGATGAAGG + Intergenic
900993508 1:6108471-6108493 GAGGGAGAATGGAAGGATGATGG + Intronic
901724297 1:11228631-11228653 GAGGAGAAAGAGAAGGATTGGGG + Intronic
901953268 1:12765347-12765369 GAGGGGAAAGAGTTGGGTGAGGG - Intergenic
903177384 1:21589151-21589173 GGGAGGAAATAGAAAGATGAGGG + Intergenic
903261338 1:22133300-22133322 GATGGGGAAGATAAGGATGAGGG + Intronic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904398558 1:30240495-30240517 GAGGAGAGATAGAAGGCTGCAGG - Intergenic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
904894094 1:33801159-33801181 GAGGGGGCATGGAAGGAAGAGGG - Intronic
905320741 1:37115310-37115332 GAGGAGAAATGGAAGGATTATGG - Intergenic
905943888 1:41885710-41885732 GAGGGGGAAGGGAAGGAGGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906228044 1:44138284-44138306 GGGGGGAATAAGGAGGATGAGGG + Intergenic
906477513 1:46179801-46179823 GAGAGGAGATGGAAAGATGAAGG + Intronic
906485811 1:46234007-46234029 GAGGAGAACTGGAAAGATGATGG - Intergenic
906558511 1:46735376-46735398 GAGTGGAAATGGAAGGACAAGGG + Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
907111352 1:51929189-51929211 GTGGGGAGTTAGAGGGATGATGG - Intronic
907333040 1:53683847-53683869 GATGTGGACTAGAAGGATGAGGG + Intronic
907582224 1:55582639-55582661 GAGGGGCAATGGAAGGAGGAAGG + Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907920756 1:58909495-58909517 AAAGGGAAGAAGAAGGATGATGG + Intergenic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
909221668 1:72970793-72970815 GAGAGGAAAAAAAAGCATGAGGG - Intergenic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
909561866 1:77016277-77016299 GAGGAGATACAGGAGGATGAGGG - Intronic
909949594 1:81704100-81704122 GAGGGGAAGTATGATGATGAAGG - Intronic
910201046 1:84699015-84699037 GTGGGGAAATGGCAGGATGGAGG - Intergenic
910324108 1:85984677-85984699 AAGCAGAAATAGAAGTATGAAGG - Intronic
910333029 1:86097591-86097613 GAGGAGAAGGAGAAGGACGAGGG - Intronic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
910713206 1:90203193-90203215 GAGGGGAGGTAGAGAGATGAAGG - Intergenic
912102948 1:106234158-106234180 GAGGGGAAGTAGAAGGTTGGAGG + Intergenic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
912925183 1:113906823-113906845 GATGGGAAGTGGAAGGAGGAAGG + Intronic
913120197 1:115732977-115732999 AAGGGGAAAAATAAAGATGAAGG + Intronic
913426889 1:118741906-118741928 CAGGGGAAATGGAAGCATTAAGG - Intergenic
913439522 1:118883356-118883378 GAAGGGAAAGGGAAAGATGAAGG + Exonic
915586870 1:156848720-156848742 GAGGGGAAACCGAGGCATGAAGG + Intronic
915691940 1:157698633-157698655 AACAGGAAATAGAAAGATGAAGG + Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
917533002 1:175853871-175853893 GACAGGAATTAGAAGGAAGAAGG + Intergenic
917563767 1:176188757-176188779 GGGGGGAAATAGCAGGTTGGTGG - Intronic
918199368 1:182252911-182252933 GAGGGGAAATAAAGAGAAGATGG + Intergenic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
919133279 1:193477288-193477310 GAGGGGAAGTAGAAAGATGATGG + Intergenic
919345994 1:196379226-196379248 GAGGGGAATTAGAAGCTAGAAGG - Intronic
919414105 1:197285299-197285321 GAGTGAAAATAGAGAGATGATGG + Intronic
920360875 1:205415270-205415292 GAAGGGAAAGAGAAGGAAAAGGG + Intronic
920447392 1:206029043-206029065 GAGGTGAAATAGTATGATGTGGG + Intergenic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
920654711 1:207867081-207867103 AAGGGTAACTAGAAGGATGGTGG - Intergenic
920663002 1:207933995-207934017 GATGGGAAGCAGAAGTATGATGG + Intergenic
920920625 1:210294697-210294719 GAGTGGAGATAGAGGGCTGATGG - Intergenic
921757010 1:218869431-218869453 GTGGGGAACTAGAAATATGATGG - Intergenic
921887508 1:220321566-220321588 GGAGGGAAAGAGAAAGATGAAGG + Intergenic
922190552 1:223314975-223314997 GATGGGAAAGAGGAGGCTGAGGG + Intronic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923801042 1:237208852-237208874 GAGGGGAAATACAAAGATGTTGG - Intronic
923930538 1:238690269-238690291 TAGGGGAAAAAGAAGGTTAAGGG - Intergenic
924481171 1:244435634-244435656 GAGGAGGAAGAGAAGGATGGAGG - Intronic
1063225659 10:4013112-4013134 GAGGGGGAAGGGAAGGACGAAGG - Intergenic
1063482848 10:6391562-6391584 GAGGGACACTAAAAGGATGAAGG - Intergenic
1063880378 10:10525481-10525503 GAGGGGAATTAGAAAGATGTTGG - Intergenic
1063986135 10:11504891-11504913 GAGTGGTAAAAGAAGGATGGTGG + Intronic
1064891756 10:20182995-20183017 GATGGGAAAAAGAAGAATCAAGG + Intronic
1066196647 10:33106699-33106721 GAGGGGAGCTGGAAAGATGATGG - Intergenic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1067978022 10:51048268-51048290 GAGGGGAAGTAAAAGAAAGAGGG - Intronic
1068036396 10:51765208-51765230 GAGGGAAAAAAGAATGCTGAGGG + Intronic
1068139873 10:52992202-52992224 GATGAGAAATAGGATGATGAGGG + Intergenic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068727516 10:60319975-60319997 GAAGGGACACAGAAGGCTGAGGG - Intronic
1069222642 10:65903569-65903591 GATGGGAACCAGAAGGGTGATGG - Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069739586 10:70678998-70679020 GAGGGGAAAGAGAAAGATCCAGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1071062421 10:81588475-81588497 GAGGGGAAACAGAAAGCTGGGGG + Intergenic
1071203360 10:83246060-83246082 GAGGGGAATTAACAAGATGATGG - Intergenic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1072078482 10:92003377-92003399 GAGGGGAAATGGATAGATGCTGG - Intronic
1072367996 10:94733946-94733968 GAGGGGAAAGCGCAGGATGTTGG + Intronic
1072681269 10:97508681-97508703 GTGGGGAAATTAAAGGAAGAAGG - Intronic
1072896076 10:99367938-99367960 GTGGGGAAAGAGAAGGACAATGG + Intronic
1073054758 10:100692239-100692261 GAGGGGAGAGGGAAAGATGATGG - Intergenic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1074268329 10:111927718-111927740 GAAGGACAACAGAAGGATGAAGG - Intergenic
1075298356 10:121297882-121297904 GAGGTGAAATCAAAGGATGGAGG + Intergenic
1075922882 10:126227722-126227744 GAGGGGAAAGAGAAAGGTGATGG - Intronic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076657360 10:132033603-132033625 GCGTGGAAACAGATGGATGATGG + Intergenic
1076778112 10:132709316-132709338 GAGGGGGAAAAGAAGGAGGTGGG + Intronic
1077097792 11:806466-806488 GCTGGGAAATGGAAGGAAGAAGG - Intronic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078612930 11:12837669-12837691 GAAGGGAGAAAGAAGGAAGAAGG - Intronic
1078692320 11:13594588-13594610 AAGGGGAAATAGGAGACTGAGGG + Intergenic
1080053922 11:27885500-27885522 TCGGGGAAATAGAATGATGAAGG + Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1081007657 11:37767060-37767082 GAGGAGAAAGAGAAATATGAAGG + Intergenic
1081488453 11:43548687-43548709 AAGGGGAAATGGGAGGCTGAGGG - Intergenic
1081896097 11:46588034-46588056 GAAAAGAAATAGAAGGAGGATGG + Intronic
1082244444 11:49905219-49905241 GGGGGGAAATAGAAGGGGGAAGG + Intergenic
1082568183 11:54706667-54706689 GAGGAGAAATAGAATCATCAGGG + Intergenic
1084344868 11:68540041-68540063 GAGGGAAAATGGAAGGAGGGAGG + Intronic
1084583413 11:70038908-70038930 GAGAGAAAATAGAAGGGGGAAGG + Intergenic
1084785710 11:71440584-71440606 GAGGGTAGATGGATGGATGATGG + Intronic
1085099206 11:73786273-73786295 AAAGGGAAAAAGAAGGAAGAAGG - Intergenic
1085295749 11:75430696-75430718 GAGAGGAAATAAACGGATGAGGG - Intergenic
1085498600 11:76996121-76996143 AGGGGGAAAGACAAGGATGATGG - Intronic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1086890170 11:92248125-92248147 GAGGGAAAAAGGAAAGATGAGGG - Intergenic
1087179874 11:95131308-95131330 GAAGGTAAATGGAAGGGTGAGGG + Exonic
1087580376 11:100043698-100043720 GAGGTGAGCTTGAAGGATGAAGG - Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087937714 11:104054707-104054729 GAAGGGGAATAGAAGGGTAAAGG + Intronic
1088235527 11:107718997-107719019 GAGAGAAAATAGAAGGAAGTGGG + Intronic
1088238343 11:107749034-107749056 GAGGGAAATTAGGAGGATGAAGG + Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088779069 11:113116338-113116360 GAAGGGAAAGAGAAGGGTGGTGG + Intronic
1088988022 11:114927129-114927151 GGGAGGAAATAGAAGGAGAAGGG + Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089325526 11:117654194-117654216 GTGGGGAAATAGGGGGATGTTGG + Intronic
1090598552 11:128345757-128345779 GATGGGAAATATAAAGACGATGG - Intergenic
1090725713 11:129525645-129525667 GAGGGGAAAGAGGAGGCTGGGGG + Intergenic
1091116478 11:133018368-133018390 GAGGGGAAAAAGAAGTAAAAAGG - Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091842061 12:3628359-3628381 GAGGAGGAATAGGAGGAGGAGGG + Intronic
1092823778 12:12377945-12377967 GAGGGGACATTGAAGGATATTGG + Intronic
1092951804 12:13510556-13510578 GTGAGGAAAGAGAAGGATCAGGG + Intergenic
1093017637 12:14170943-14170965 GAGAGGAAGGAGAAGGGTGAGGG + Intergenic
1093530403 12:20155046-20155068 GAGGGGGAAGAGAAAGAAGAAGG + Intergenic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094716426 12:33018995-33019017 GATGGGAACTAGAAAGAAGATGG - Intergenic
1095180295 12:39140094-39140116 AAGGGGAAAAATAATGATGAAGG - Intergenic
1095309988 12:40687413-40687435 GAGGGAAAAAAGGAGGGTGAGGG - Intergenic
1095463866 12:42470226-42470248 GAGGTAAAATAGCAGGAAGAAGG - Exonic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1096864252 12:54552178-54552200 GAAGGGAAATAAAAGGATTTAGG + Intronic
1096884264 12:54700764-54700786 GAGGGGATATAGAAATATGCAGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097357992 12:58623446-58623468 TAGGGGAAACAGAACAATGAAGG - Intronic
1097477653 12:60078608-60078630 GATAGGAAAGAGGAGGATGAGGG - Intergenic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1097842624 12:64336827-64336849 GAGGGAGAAGGGAAGGATGAAGG - Intronic
1098512896 12:71339794-71339816 GAGCGGGAAGAGAAGGAGGAGGG + Intronic
1098550204 12:71754382-71754404 GTGGGGGAATGGAAGGATGGGGG + Intergenic
1098701321 12:73631222-73631244 GAGGTGGAAGAGAAGGAGGAGGG + Intergenic
1098828773 12:75332891-75332913 CAGGGGATATAGAATGATCAGGG + Intronic
1098881542 12:75922265-75922287 GAGAGGAAATGGAAGAATGGTGG - Intergenic
1098937879 12:76501372-76501394 GAAGGAAAATAGAAGGGAGAGGG + Intronic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099769705 12:87035276-87035298 GAGAGGAAATAGAGGGATGGAGG + Intergenic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1101695724 12:107124140-107124162 GAGGGGTAATAGAGAGATGTTGG + Intergenic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1101812265 12:108117972-108117994 GAGGGGAAATGGGGGGATGTTGG - Intergenic
1102015777 12:109646969-109646991 AAGGTGAAAGAGAAGGATAAAGG - Intergenic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102816520 12:115870414-115870436 GATTGGAAATAGAAGGATCGGGG - Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103397466 12:120619125-120619147 GAGGGGGAAGAGAGGGCTGAAGG - Intergenic
1103423773 12:120813090-120813112 GAGGGTAAATATAAGGATAAGGG + Intronic
1103624010 12:122205100-122205122 GAGGGGAGAAAGAAGGGAGACGG - Intronic
1104075839 12:125388971-125388993 GAGGGGCAATAGAAAGACAAAGG - Intronic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1105387384 13:19943955-19943977 GAGGGGAATGAGAAGGGAGATGG + Intergenic
1105703397 13:22950793-22950815 GAGGAGAAATAGAAGGAGACAGG + Intergenic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106510081 13:30405571-30405593 GAGTACAAATAGAAGGTTGAAGG + Intergenic
1107034768 13:35889625-35889647 GGGGGGAAAGAAAACGATGATGG - Intronic
1107584990 13:41836287-41836309 GAGAGGAGATGGCAGGATGAAGG + Intronic
1109119525 13:58436595-58436617 GATGGGATATAGAGGGATGCAGG + Intergenic
1109147692 13:58801808-58801830 GAAGGGAAAAGGAAGGAAGAAGG + Intergenic
1109900700 13:68765727-68765749 CAGGGGAAATGGGAAGATGATGG + Intergenic
1109992533 13:70077663-70077685 TAGGGGAAATTGGAGGATAATGG + Intronic
1109994319 13:70103420-70103442 GTGGGGAAAAAGGAGAATGAGGG + Intronic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1111252523 13:85621735-85621757 TGGGGGAAATGGAAGGATGTTGG + Intergenic
1111374170 13:87355742-87355764 GAAGGGAAAAAGAAGTATGTTGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1112137345 13:96595629-96595651 GAGGGAGAATAGAAAGATAAAGG - Intronic
1112151577 13:96770582-96770604 GAGAGGAAATAGAAGGATATTGG + Intronic
1112256557 13:97838196-97838218 GAAGGGAATTAAAAGGATAAGGG - Intergenic
1112433310 13:99372381-99372403 GGGGGGAAAATGAAGGATGATGG + Intronic
1112463224 13:99621283-99621305 GGGGGGAAATGGAAAGATGGAGG - Intronic
1112644085 13:101309903-101309925 GAGGGGAAATATGAGGATCTCGG - Intronic
1112770724 13:102792062-102792084 GAGGAGCAAGAGAAGTATGACGG + Intronic
1113042668 13:106121513-106121535 GAAAGGAAATAAAATGATGATGG + Intergenic
1113082024 13:106530245-106530267 GGGGGGAATTAGAAGGAGGCTGG - Intronic
1113350809 13:109527379-109527401 GAGGGAAAAAAGAAGGAAAAGGG - Intergenic
1113883356 13:113642030-113642052 AAGGGGAAAGAGAAAAATGAAGG - Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114285464 14:21238663-21238685 GAGGGGAAATATGATGATGAGGG - Intronic
1114412041 14:22509919-22509941 GAGGGGAAAGAGAAGGCTAAGGG + Intergenic
1114769131 14:25408693-25408715 GAGACCAATTAGAAGGATGATGG + Intergenic
1115326787 14:32148436-32148458 GAGAGTAACTATAAGGATGATGG + Intronic
1115347726 14:32361166-32361188 GAGGGGAATGCGGAGGATGAGGG + Intronic
1115350948 14:32395171-32395193 GAGGTGAAAGAGAAAGAAGATGG - Intronic
1115384515 14:32780369-32780391 GAAGGGAAATGGAAAGATGTAGG + Intronic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1116682513 14:47991564-47991586 GGGGGGAAATAGAAGGAAAAGGG - Intergenic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116974877 14:51105049-51105071 GAGGGGTAATTGAAGGTAGAAGG + Intergenic
1117402488 14:55370942-55370964 GAGGGGAAAAAGAAGCAGAAAGG - Intronic
1117689721 14:58294040-58294062 AAGTGGAAATATAAGGCTGAAGG - Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118517937 14:66547088-66547110 GAAGGCAAAAAGAAGCATGAGGG - Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120278859 14:82413580-82413602 GAGGGGAAATAGAAGGGGATAGG - Intergenic
1120383852 14:83819086-83819108 GTGGGGAAATAGAAAAAAGAGGG - Intergenic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121064263 14:90946539-90946561 GAAGGGAAAAGGAAGGATGAAGG - Intronic
1121226622 14:92325911-92325933 GTGGAGAAATAGAAAGTTGATGG + Exonic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121967278 14:98322136-98322158 GAGAGGAAATGGAAGGAAAAGGG - Intergenic
1122056398 14:99101086-99101108 GAGGGGAAATGGGAGGGTGGGGG - Intergenic
1124139793 15:27067356-27067378 GAGGGGACACAGAAGGGTGCGGG - Intronic
1124497025 15:30192926-30192948 GAGGGGAGAAAGAGGGATGCAGG + Intergenic
1124647668 15:31450426-31450448 GAAGGGAAAGGGAAGGAAGACGG + Intergenic
1124709757 15:31998035-31998057 AAGGGGAAATTTGAGGATGATGG + Intergenic
1124746551 15:32345721-32345743 GAGGGGAGAAAGAGGGATGCAGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125545704 15:40502791-40502813 GAGGAGGCATAGGAGGATGAAGG + Intergenic
1125803544 15:42472485-42472507 GGGGTGAAAAAGAAGGATCAAGG - Intronic
1126428112 15:48551233-48551255 GAGGAAAAATAGAAGGACCAGGG - Intronic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1127160322 15:56176709-56176731 GAGGGGAAACAGAGGAATCAAGG - Intronic
1127343118 15:58066605-58066627 GAGGGGAAACAGCCGGAAGAGGG - Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128572255 15:68742322-68742344 GAAGGGAAATAGAAAGGGGATGG + Intergenic
1128613838 15:69094264-69094286 GAGGGAAAAAGGAAGGAAGAAGG + Intergenic
1128789702 15:70423913-70423935 GAGGGGCAAAAGGAAGATGAGGG - Intergenic
1129901669 15:79156361-79156383 GAGGGGAGACAGAGAGATGAGGG - Intergenic
1129970446 15:79773654-79773676 GAGCTGAAAAAAAAGGATGAAGG + Intergenic
1130266652 15:82411140-82411162 GAGGGGAAAATAAAGGTTGAGGG - Intergenic
1130505373 15:84535746-84535768 GAGGGGAAAATAAAGGTTGAGGG + Intergenic
1131340977 15:91600481-91600503 GAGGGGATATTGAAGGTTTAAGG - Intergenic
1131434517 15:92412347-92412369 GAGGGGAAGAGGAGGGATGAAGG + Intronic
1132584557 16:700604-700626 GAGGGGATATCGCAGGATGCCGG + Intronic
1133204757 16:4226651-4226673 AAGGGTGAATGGAAGGATGATGG + Intronic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1133520157 16:6549194-6549216 GAGGGGAAAAGGGAGGAGGAGGG + Intronic
1133997872 16:10761945-10761967 GAGGGGCAATGGAAGGAGGAGGG + Intronic
1134278859 16:12800757-12800779 GATGGGAAAGGGAAGGATGAGGG - Intronic
1134610268 16:15602637-15602659 GAGGAGAAAGAAAAGGAGGAGGG + Intronic
1134800185 16:17077028-17077050 GAGAGGAAAGAGGTGGATGATGG - Intergenic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1135495022 16:22943821-22943843 AGGGGGATACAGAAGGATGAGGG + Intergenic
1135891777 16:26363797-26363819 GAGGAGAAAGAGAAAGAAGAAGG - Intergenic
1135979080 16:27132618-27132640 GGGAGGAAATTGAATGATGAGGG + Intergenic
1137413031 16:48245180-48245202 AAAGGGAAACAGAAGGATTAGGG - Intronic
1137539635 16:49353409-49353431 GGAGGAAAAGAGAAGGATGAAGG - Intergenic
1138799285 16:60006952-60006974 GATAAGAAAAAGAAGGATGAAGG - Intergenic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138946543 16:61858136-61858158 GAGGGGGAATAAGAGGAGGAAGG + Intronic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139090255 16:63637564-63637586 GTGGGGACATAGAGGGATGTGGG + Intergenic
1139127795 16:64101165-64101187 GAGGGGAAAAAGGATGATGCTGG + Intergenic
1139328432 16:66169383-66169405 GAGGGGAAAGAAAAGTAGGAAGG + Intergenic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG + Intronic
1140046405 16:71442719-71442741 GAGGGGAAATAGAAGCTCAAAGG - Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140398484 16:74649807-74649829 GAGGGGAAAAAAATGGGTGAGGG - Intronic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1140964404 16:79950885-79950907 GAGGTAAAAGAGAAGAATGAGGG + Intergenic
1141059880 16:80856631-80856653 GAGTTGTAATAGATGGATGAAGG - Intergenic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1143616269 17:8051873-8051895 ATGGGGCAATAGAAGGATGAAGG - Intergenic
1143807840 17:9444073-9444095 GACAGGAAATAGAAGTGTGAGGG - Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144664475 17:17092548-17092570 AAGGAGAAAGAAAAGGATGAGGG - Intronic
1145770792 17:27491679-27491701 GAAGGGAAATAAAAGTATGCTGG + Intronic
1146497209 17:33333788-33333810 GAGAGGAAAGAGGAGGATTATGG + Intronic
1146596476 17:34173404-34173426 GTGGGGAAATGCAAGGAGGAGGG + Intronic
1146853420 17:36242999-36243021 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1146869330 17:36366891-36366913 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147072204 17:37967515-37967537 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147083729 17:38047052-38047074 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147099675 17:38171019-38171041 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147675378 17:42201870-42201892 GAGGGAAAGAAGAGGGATGAAGG + Intronic
1147910929 17:43855512-43855534 AAGGGGAAATGGGAGAATGAAGG + Intronic
1148260638 17:46180115-46180137 TAGAGGAAATAGTAGAATGAAGG + Intronic
1148750053 17:49940442-49940464 GAAGGGAAATGGCAGGATGTTGG + Intergenic
1149414815 17:56448228-56448250 GAAAGAAAATAGAAGGAAGAAGG + Intronic
1149466083 17:56880271-56880293 GAAGTGAAAGAGTAGGATGAAGG + Intergenic
1149518072 17:57295309-57295331 GAGGGGAGCTAGAAGGGTGCTGG + Intronic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1150980382 17:70134977-70134999 AAGGAGAAAGGGAAGGATGAGGG - Exonic
1151304137 17:73252103-73252125 GAGTGGGAATAAAGGGATGAGGG + Intronic
1151627690 17:75287776-75287798 GAGGGGAAAGGGAAAGGTGAAGG - Intronic
1152322357 17:79614821-79614843 GAGGAGAAAAAGAAGAAAGAGGG + Intergenic
1152368320 17:79870220-79870242 GAGGGGAAGTGGGAGGAGGAAGG - Intergenic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1155450283 18:25956179-25956201 GAGGTGGAAAATAAGGATGAGGG - Intergenic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1156198737 18:34806366-34806388 GAGGGGACATAGAGGAATGAGGG - Intronic
1156333708 18:36149809-36149831 AAGGGGAGATAAAAGCATGAAGG - Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157551227 18:48583053-48583075 GAGGGGAGGGAGGAGGATGATGG + Intronic
1157569901 18:48705348-48705370 GAGGAGACACAGAGGGATGAAGG - Intronic
1157618764 18:49003325-49003347 GAGGGGAAAAGGGAGGAGGATGG - Intergenic
1157895206 18:51460082-51460104 AAGGGGAAAGATAAGGATGGAGG - Intergenic
1157993174 18:52521842-52521864 GAGAGGCAGTAGTAGGATGAGGG - Intronic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158410324 18:57199519-57199541 GCGGGGAAGTAGAAGGAGGTAGG - Intergenic
1158776250 18:60583579-60583601 GAGTGAAAAAGGAAGGATGACGG - Intergenic
1158873197 18:61708851-61708873 CAGGTGAACTAGAGGGATGAAGG - Intergenic
1159004170 18:62998238-62998260 GATGGGAAATAGATGGCTGTGGG - Intergenic
1159079756 18:63724063-63724085 GAGGAGGAAGAGAAGGAAGAAGG - Intronic
1159235605 18:65669067-65669089 TGGGGTAAATAGAAAGATGATGG - Intergenic
1159727211 18:71976038-71976060 GAGGGAAAATAAAAAGATGAAGG - Intergenic
1160331623 18:77998081-77998103 GAGGCGACACAGAAGGAAGAAGG + Intergenic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162716327 19:12636684-12636706 GAGGGGAAAAAGGGGGATGAAGG - Intronic
1163462143 19:17445426-17445448 GTGGGCAAGTAGATGGATGATGG - Intronic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163669811 19:18620835-18620857 GAGGGGACATAGAAGGAAAAAGG - Exonic
1164856324 19:31527460-31527482 GAAGGGAAACAGAAGGGTGAGGG + Intergenic
1166340572 19:42134489-42134511 GAGGGGATCTTGAAGGAGGATGG + Intronic
1166614461 19:44230684-44230706 GATGGAAAATGGAAGGAAGATGG - Intronic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167628765 19:50609873-50609895 GAGGGGCAATGAAGGGATGAAGG - Intergenic
1167685412 19:50952863-50952885 GAGGGGACAGAGAAAGATGTGGG + Exonic
1167724296 19:51200247-51200269 GAGGGGAGAGGGAAGGATGGGGG - Intergenic
1167737542 19:51305365-51305387 CAGGGGAGATAAAAGCATGAAGG - Intergenic
1167862832 19:52298746-52298768 GAGAAGGAATAGAAGGAAGAAGG + Intronic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1168143879 19:54408430-54408452 GAGGGGAAAAGGAAGGAAGAAGG + Intergenic
925032198 2:659626-659648 GAGGGAGAAAAGAAGGAAGAAGG + Intergenic
925745255 2:7038621-7038643 GAGGTGGAAAAGAAGAATGAGGG + Intronic
925842591 2:8006582-8006604 GAGGAGGAAAAGAAGGATGGAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926592108 2:14750968-14750990 GAGAGGAAAGAAAAGGATGAGGG + Intergenic
926653782 2:15376056-15376078 TAGGGGAACTAGAATGAGGAGGG + Intronic
927001736 2:18802594-18802616 CAGGGGAAAGAAAAGGATAATGG + Intergenic
927343558 2:22010226-22010248 GAGGGGAAAGGGAAGGGGGAGGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
927785675 2:25972838-25972860 GAGGGGAAAGAGAAAGAGGTGGG - Intronic
928250810 2:29677221-29677243 GAGGGGAGAAGGAAGGAAGAAGG - Intronic
929242237 2:39665554-39665576 AAGGGGAGAGAGGAGGATGAGGG + Intronic
929494252 2:42425476-42425498 GAAGAGAAATAGAGGGATGATGG + Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929914694 2:46124794-46124816 GTGGGGAATGATAAGGATGATGG + Intronic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
931152814 2:59593969-59593991 GTGGGGAAATGGAAGGTGGAGGG + Intergenic
931825876 2:66000533-66000555 GATGAGAGAAAGAAGGATGAAGG + Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932186376 2:69699735-69699757 GAGGGGTAATAAAAAGATGCAGG + Intronic
932627570 2:73310365-73310387 GAGGGGAAATAAGAAGATGTTGG - Intergenic
932738849 2:74276182-74276204 GAGGGGAAATAAAAGGACAGGGG + Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
933441107 2:82315400-82315422 GAGGGGGAGGAGAAGGAAGAGGG - Intergenic
934902554 2:98172244-98172266 TAGGGGAGCTAGAAGGGTGATGG + Intronic
935370625 2:102342878-102342900 GAGAGGACATAGAAAGAGGAAGG + Intronic
935606366 2:104975544-104975566 GAGGGGAAGTGGAAGGTTGGTGG + Intergenic
936958409 2:118047213-118047235 GATGGGAAAAAAAAGCATGATGG - Intergenic
937060385 2:118976465-118976487 GAGGGGAAATTGAGGGATCCAGG - Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937265736 2:120613696-120613718 GAGGGGAAAGAGAACGCTGGAGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937795774 2:126018530-126018552 GTGGGGAAATAGAGGAATGCTGG - Intergenic
939070437 2:137534122-137534144 AAGGGGAAATGGAAAGATTAGGG - Intronic
939117503 2:138077249-138077271 GTTGGGAAAAAAAAGGATGAGGG - Intergenic
939175184 2:138739993-138740015 GAGCAGAGATAGAGGGATGAGGG - Intronic
939844652 2:147228736-147228758 GACAGGATAGAGAAGGATGAAGG - Intergenic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941255198 2:163220617-163220639 GAGGGGAACTGGATGGCTGAGGG - Intergenic
941601326 2:167546925-167546947 CAAGGGAAAGTGAAGGATGAGGG - Intergenic
942327817 2:174790479-174790501 GAGGGTGACTACAAGGATGATGG - Intergenic
942839497 2:180342077-180342099 AAAGGAAAATAGAAGGATGCTGG - Intergenic
943118524 2:183705326-183705348 GAAGGGTAAAAGAAGGGTGAGGG + Intergenic
943821113 2:192322172-192322194 AAGAGAAAATAGAAGCATGAAGG - Intergenic
944483639 2:200181344-200181366 GAGGGAAAATAGAAGCAGGCAGG - Intergenic
945160324 2:206883945-206883967 GAGAGAAAATAGAAGGACCAGGG - Intergenic
945617077 2:212085078-212085100 GTGGGGAAAGATAAAGATGAGGG - Intronic
946307892 2:218866245-218866267 GTGGGGAAATAGAGGGAGGCTGG + Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946507575 2:220317912-220317934 GAGGAGAGAAAGAAGGATCACGG - Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1169982529 20:11402122-11402144 GATGGGAAATACAAGATTGAGGG - Intergenic
1170141561 20:13129986-13130008 GAGGCAAAATAGGAGAATGAGGG + Intronic
1170536545 20:17346404-17346426 GAGGAGGAACAGAAGGATGGTGG - Intronic
1172250440 20:33475751-33475773 GAGGGGAGAGTGAAGGATGCTGG - Intergenic
1173069535 20:39749182-39749204 AAGAGAAAATAGAAAGATGAAGG - Intergenic
1173780179 20:45749411-45749433 GAGAGGAAATAGACTGATGGAGG + Intronic
1174216519 20:48920743-48920765 GAGGGGAAAGAGTAGGAGAAAGG - Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1174973073 20:55299841-55299863 GTTGGGAAATAAAAGGAGGATGG + Intergenic
1175456604 20:59120097-59120119 GAGAGCAAAAAGAGGGATGATGG + Intergenic
1175754120 20:61518548-61518570 GATGACAAATAGAAGGATGATGG - Intronic
1177438136 21:21082835-21082857 GAGAGGAAACAGAAGTACGAAGG - Intronic
1177724979 21:24955614-24955636 GAGGGGAAACAGTAGGATAAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178005140 21:28210365-28210387 GAGGAGAACCAGATGGATGATGG - Intergenic
1179032734 21:37734725-37734747 GAAGGGAAATAAAGGGATGCAGG + Intronic
1179246072 21:39635272-39635294 TAGAGGAAATAGGAGGTTGAGGG + Intronic
1179311080 21:40196649-40196671 GAGGGGAAAGTGAAGAAGGAAGG - Intronic
1180250544 21:46583809-46583831 GCTGGGAAATCGAAGAATGAGGG - Intergenic
1181180568 22:21065251-21065273 GAAGGTAAATAGAAGGGAGAAGG - Intergenic
1181528286 22:23502309-23502331 GATGGGAGATAGAGGGATGGAGG - Intergenic
1181612760 22:24029707-24029729 GAGTGGAAATAGAAGGCAGTGGG + Intronic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1182157953 22:28093462-28093484 TAGGGGAAATCAAAGGAAGAGGG - Intronic
1182740969 22:32567294-32567316 CAGGTGCAATAGAACGATGACGG + Intronic
1182754559 22:32668376-32668398 GAGGGGAAAGAGAAGGGGAAAGG - Intronic
1182804923 22:33061177-33061199 AATGGGAAATAAAAGGATCAAGG + Intergenic
1183512157 22:38242634-38242656 GAGGGGAAATACAAGGATCGGGG + Intronic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184137897 22:42560161-42560183 GGGGGGAGACAGAAGGATGCTGG - Intronic
1184293370 22:43509597-43509619 GGGGGTGAATAGAGGGATGATGG - Intergenic
1184533793 22:45072751-45072773 GAGGGCAAATGGAGAGATGAGGG - Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185242412 22:49753781-49753803 GAAGGAAAATAGAAGTTTGAAGG - Intergenic
949330847 3:2920296-2920318 GAGGGGAGGTAGAAGGAGGCTGG + Intronic
950168736 3:10821341-10821363 CATGGCAAATAGAATGATGATGG + Intronic
950901850 3:16505100-16505122 GATAGGAATTAGATGGATGAGGG - Intronic
951008014 3:17641585-17641607 GAGGAGGAATAGGAGGAGGAAGG - Intronic
951140144 3:19148565-19148587 CAGGGGAAGTGGAAGGATGGAGG - Exonic
951216204 3:20027660-20027682 GAGTGGGAAAAGAAGGAGGAAGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
953142043 3:40238145-40238167 GAAGGGAAGGAGAAGGAAGAAGG - Intronic
953721954 3:45363919-45363941 GAGGAGGAATAGAAGAAGGAGGG - Intergenic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954095380 3:48322268-48322290 GAGGGGAAATAGTTGGAAGAGGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954452116 3:50577280-50577302 GAGGGGAAGCAGCTGGATGAGGG + Intronic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
955912860 3:63875515-63875537 GTGGGGAAATAAAAAGATGCTGG - Intronic
955972120 3:64445806-64445828 GAGTGGAGATGGAAGGATGAGGG + Intergenic
957397484 3:79660963-79660985 GAGGGAAATTAGAAGGCTGAAGG - Intronic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958923228 3:100129348-100129370 AAGGGGAAGAAGAAGGTTGAAGG + Intronic
959340463 3:105123197-105123219 AAGGGAAAATAAAAGGGTGAGGG + Intergenic
959479164 3:106850166-106850188 GGGGAGAAAGAGAGGGATGAAGG + Intergenic
960165743 3:114399398-114399420 CATGTGAAATAGAAGGATAATGG + Intronic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
960192120 3:114719194-114719216 GGGGGGAAATAGAAGCAAGAAGG + Intronic
960715223 3:120568627-120568649 GAGGGTTATTATAAGGATGAAGG - Intergenic
960822865 3:121752891-121752913 GGGGGGAAAAAGAAGAAGGAAGG + Intergenic
960930891 3:122848514-122848536 GAGGAGAAATATAATGATCATGG - Intronic
961347750 3:126275037-126275059 AAAGGGAAAAAGAAGAATGAAGG - Intergenic
961747877 3:129077143-129077165 GAGAGGAATGAGAAGGAAGAGGG - Intergenic
961906270 3:130265773-130265795 GAGTGGTAATAGAAGGCTGATGG + Intergenic
962037431 3:131667581-131667603 GAGGGGGGAGAGAAGGATCAGGG - Intronic
962818786 3:139026513-139026535 GAGGGGAGTTAGAAGGGTCAGGG - Intronic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
963471082 3:145742658-145742680 GAGGGGAAAGAGAAAGAAGCAGG - Intergenic
963602192 3:147388350-147388372 GAGGGGAAAGAAAAGGAGAAAGG - Exonic
963986603 3:151602724-151602746 GATGGGAAAATGAAGTATGAAGG - Intergenic
964008978 3:151866774-151866796 GGGGGGAAATAGTAGAATAAAGG + Intergenic
964124333 3:153220353-153220375 GAGGGGAAAGAGAGGGATATAGG - Intergenic
964317201 3:155457230-155457252 GCTGGGAAAAAGGAGGATGATGG + Intronic
964411153 3:156399141-156399163 GAGGGGAAAATGAAGGCTGCTGG - Intronic
965023890 3:163273035-163273057 GAAGAGAAATAGGAGGAAGAAGG + Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
966319891 3:178690516-178690538 GAGGAGAATGAGAAGGAAGAAGG + Intronic
966527238 3:180932705-180932727 GAAGGGAAAGAGAAGTATGTAGG + Intronic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
967708444 3:192679180-192679202 GATGGGAAATAGAAGCAGCAGGG + Intronic
967986933 3:195102052-195102074 GAGGAGGAATGGAAGGAGGAAGG + Intronic
968620037 4:1599918-1599940 GAGAGGAAATAGGAGGGGGAGGG - Intergenic
968817195 4:2828270-2828292 CAGGGAAAATGGAAGGATCAAGG - Intronic
969270327 4:6095199-6095221 GGAGGGAAATAGAAGAAAGAAGG + Intronic
969285119 4:6198317-6198339 GGGGGGAAAAAGAAGCATGTGGG + Intronic
969424854 4:7118212-7118234 GATGGGAGATGGATGGATGATGG + Intergenic
969916713 4:10498562-10498584 GAGAAGATATAGAAGGATAAAGG + Intronic
970188134 4:13484185-13484207 GGGGGGGAAGGGAAGGATGAAGG + Exonic
970300235 4:14673506-14673528 GAGGGGTAATTGAATCATGAGGG - Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
971255422 4:25009478-25009500 GAGGGGAAATAAAGTGAAGAAGG - Intronic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
973765973 4:54163242-54163264 GAGGGGAAGGAGAAGGAAGTGGG - Intronic
974186647 4:58455957-58455979 GAGGTGAAATTTAAGGAAGAGGG + Intergenic
974317613 4:60302915-60302937 GAGTGGAAATAAAAGAAGGATGG + Intergenic
975190876 4:71460647-71460669 CAGGGGAAATAAAAAAATGAGGG + Intronic
975366561 4:73536300-73536322 GGGGAGAAATGGAAGAATGAAGG + Intergenic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
976204992 4:82616173-82616195 GGGGGAAAATGGAAGGCTGAAGG + Intergenic
976314966 4:83650287-83650309 GATGAGAAATGGAAGGTTGAAGG + Intergenic
976572751 4:86632627-86632649 GAGGAGAAAGAGAAAGAAGAAGG - Intronic
977708815 4:100101033-100101055 TAGGGGAGGTAGAAGGCTGAAGG + Intergenic
978071614 4:104479732-104479754 GAGGGGAAAAAGAAAGAAGGAGG - Intronic
978921793 4:114192890-114192912 GAAGGGAAAGTGCAGGATGATGG - Intergenic
979023253 4:115530413-115530435 GAGGGGAATAATAATGATGATGG + Intergenic
979114344 4:116802248-116802270 GAAGGGAAAGAGAAGGCTTATGG - Intergenic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
979416891 4:120452429-120452451 GAGAGGGAAAAGAAGGAGGAAGG + Intergenic
979742136 4:124165338-124165360 TAGGGGAGAGAGAAGGAAGAGGG - Intergenic
979834951 4:125354681-125354703 GTGTGGAAATGGAAGAATGAAGG + Intronic
980092331 4:128455623-128455645 GAGGGGGAAGGGAAGGAGGAAGG + Intergenic
980751748 4:137099450-137099472 GATGGCAAATAGATGGATCATGG - Intergenic
980989564 4:139727783-139727805 GAGGGAAAACAGAAGGATTTGGG - Intronic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
982725682 4:158903272-158903294 GAGGGCAAGTAGAAGGAGGGTGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984483685 4:180337960-180337982 GTGGTGAAGTAGAAGGATAATGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
985349988 4:189049829-189049851 GAGGGGAAAAATAAGAATGAAGG - Intergenic
985691299 5:1314237-1314259 CAAGGGAAATGGCAGGATGAGGG + Intergenic
986278649 5:6304497-6304519 GAAGGGAAAAAGATGGAAGAAGG + Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986800785 5:11257928-11257950 GAGGAGTAATAGGAGAATGATGG - Intronic
986824615 5:11507151-11507173 GAGGTGAAAGAGAAGTATTATGG - Intronic
986928545 5:12790347-12790369 GAGTAGAAATAGAGAGATGAGGG + Intergenic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987151183 5:15041800-15041822 GAGAGGAAATAGGAAGATGTAGG - Intergenic
988133529 5:27137678-27137700 GAATTGAAATTGAAGGATGAAGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988292650 5:29309338-29309360 GATGTGAAACAGAATGATGATGG - Intergenic
988773188 5:34452048-34452070 GTGGGGAAATAGAAGGGTGAAGG - Intergenic
989180329 5:38569908-38569930 AAGGGGGAATAAAATGATGAGGG - Intronic
989664705 5:43840732-43840754 GTGTGGAAATATAAGGATAAGGG + Intergenic
989747139 5:44842766-44842788 CAGGAGAGATGGAAGGATGAAGG + Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
993190471 5:84673478-84673500 AAGGGGAGATAAAAGCATGAAGG + Intergenic
993304247 5:86255114-86255136 GAGGTGAAATAAAAGGCTTAAGG - Intergenic
993317569 5:86429901-86429923 GAGGAGAAATTGAAACATGAAGG - Intergenic
993564029 5:89450405-89450427 GTGGGGAGCTAGAGGGATGAGGG + Intergenic
994371578 5:98973336-98973358 GAGGAGAAGTGGTAGGATGAGGG + Intergenic
994679882 5:102873266-102873288 GAGGGGAAACAGAAAAATGGTGG - Intronic
995002310 5:107148869-107148891 GAGGGGAAAGGAAAGGAAGAAGG + Intergenic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995350818 5:111173364-111173386 AAGGAGAAATATAAAGATGAAGG + Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995537632 5:113153258-113153280 GAGGGGAGATATAATGAGGAAGG - Intronic
996168039 5:120250619-120250641 GAGGAGAAATAGAAGATTGGTGG + Intergenic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
996479081 5:123952952-123952974 GAGGTGAGATATAAGGAGGAGGG + Intergenic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
996617037 5:125454280-125454302 AAAGGGAAACAGCAGGATGAAGG + Intergenic
996904167 5:128578489-128578511 GAGGGGAAACAAAAGAAAGAAGG - Intronic
997203031 5:132024222-132024244 GAATGGAAATAAAAGGATGAGGG - Intergenic
997804640 5:136905092-136905114 GAGGAGGAAGAGAAAGATGAAGG - Intergenic
998370190 5:141655844-141655866 GAGGGGAAAGAAAAGGCTGAGGG - Intronic
998481064 5:142463337-142463359 GAGGTGAAATCGCAGGGTGAGGG + Intergenic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
998959097 5:147465859-147465881 GAAGAGAAAAAGAAGGATCAGGG - Intronic
999000241 5:147912920-147912942 GAGGGGAAAGAGAAGAGAGAAGG + Intergenic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
999344463 5:150803764-150803786 GAAGGTAAATAGAAGCATAAAGG - Intergenic
999467845 5:151823814-151823836 GAGATGAACTAGAAGGATCAGGG - Intronic
999487473 5:152012961-152012983 AAGGGGGATTTGAAGGATGATGG - Intergenic
1000232973 5:159332448-159332470 GAGCGGAAAAGGGAGGATGAGGG - Intergenic
1000311190 5:160046479-160046501 GAGGGGAAAAAAAAAGAAGAGGG - Intronic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000841048 5:166219049-166219071 GAGGGGAAAAGGAAGGAAGGAGG + Intergenic
1001084439 5:168690557-168690579 GAGGGGACAGGGAAGAATGAAGG - Intronic
1001108495 5:168875790-168875812 GAAGGGAAAGAGAAGGGTGGAGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001300641 5:170531205-170531227 GAGGGGAATTATTATGATGATGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002091490 5:176809454-176809476 GAGGGGAATGAGCAGGGTGAGGG - Intergenic
1002381331 5:178831950-178831972 GAGGGGAAAGAGCAGGTTGGGGG - Intergenic
1003759690 6:9162771-9162793 GAGGGGAAAGAGAGAGAAGAAGG + Intergenic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004899514 6:20181392-20181414 GAGGGGAAGAAGAAGGCAGAAGG - Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1006557872 6:34884418-34884440 AAGGGTATATGGAAGGATGAAGG + Intronic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1006992309 6:38225756-38225778 GAGAGGAAAAAGAAGCATCAGGG + Intronic
1007166816 6:39834305-39834327 GAGTGAAAAAAGAAGGATGTAGG - Intronic
1007368597 6:41411817-41411839 GACAGGGAAGAGAAGGATGAGGG - Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008125736 6:47666141-47666163 GAGGAGGAATAGGAGGAGGAGGG - Intronic
1008498563 6:52156972-52156994 GAGTGGAGAAAGAAGGATGGAGG + Intergenic
1008617093 6:53237141-53237163 GGGGGGAATGAGAAGGATGGAGG - Intergenic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1009043105 6:58205270-58205292 GAGGGGCAATAAGAGGATCAGGG - Intergenic
1009218942 6:60959519-60959541 GAGGGGCAATAAGAGGATCAGGG - Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1011421177 6:87175224-87175246 GAGGGGAAAAAAAAGAATTAAGG - Intronic
1011905406 6:92360775-92360797 TAAGGGAAATTTAAGGATGATGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012350123 6:98240109-98240131 GAGGGGAAACTGAAGAGTGATGG - Intergenic
1012952388 6:105532281-105532303 GAGGGGAGAGATAAGGCTGAAGG + Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1013863741 6:114668196-114668218 GAAGGGAAAGGGAAGGATAAGGG + Intergenic
1014096757 6:117469670-117469692 AAGGGGAAATAAAAGCATGAAGG - Intronic
1014318339 6:119894498-119894520 GAGGAGGAAGAGAAGGACGAAGG - Intergenic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1014862565 6:126487772-126487794 TAAGGGAAATAGGAAGATGATGG - Intergenic
1015113359 6:129619268-129619290 GAGGGGGAAAAGAAAGAGGAGGG + Intronic
1015238932 6:131002344-131002366 GAGGGGAGAGAGAAGAAAGAAGG + Intronic
1015798598 6:137037883-137037905 GAGTGAAAATTGAAGGATCAAGG + Intronic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1017805174 6:157939635-157939657 TGGGAGAAAGAGAAGGATGAGGG + Intronic
1018881224 6:167883155-167883177 GAAGGGAATTCCAAGGATGATGG + Intronic
1019103388 6:169649991-169650013 GAGGGGGAATAGAGGGATGGAGG - Intronic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1021381502 7:19972745-19972767 AAGGGGAAAGAGAAGTATAATGG + Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021536412 7:21709619-21709641 GAGAGGATAGAGAATGATGAAGG - Intronic
1021841900 7:24727792-24727814 GAGGGGAAATCGGCAGATGAAGG - Intronic
1022485795 7:30776709-30776731 GAGAGGGAAGACAAGGATGAAGG - Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024747976 7:52429687-52429709 GAAGGGAAATGGAAGGAACAAGG - Intergenic
1024756027 7:52532463-52532485 GAGGGGTAAAAGAATCATGAGGG - Intergenic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026261421 7:68758928-68758950 GAGGGGAAAAAGAAGAGTGAGGG + Intergenic
1026452471 7:70541200-70541222 GAAGGCAATTAGAAGGATGCAGG - Intronic
1026462438 7:70626656-70626678 GAGGCGAGAGGGAAGGATGAGGG - Intronic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1027652795 7:80891255-80891277 GACGGGATATAGACGGAAGATGG - Intronic
1027765872 7:82340892-82340914 GAGTGGAATTAGAATGATGGTGG - Intronic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029438956 7:100577019-100577041 GAAGGGAATTAGAGGGATGATGG + Intronic
1029799054 7:102926432-102926454 GAGGGATAATAGAAAGATAATGG - Intronic
1030417080 7:109258580-109258602 TTGGACAAATAGAAGGATGAAGG - Intergenic
1030473911 7:110003582-110003604 GAAGGGAAGGAGGAGGATGAAGG + Intergenic
1031079409 7:117243629-117243651 GAAGGAAAATGGAAGGAGGAAGG + Intergenic
1031272050 7:119663896-119663918 GAGGGGAAGTAGAGGGTTGAGGG + Intergenic
1031495202 7:122438472-122438494 GAGAGGAAGTGGAAGGGTGAGGG + Intronic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1032982995 7:137306377-137306399 GAGGGTAGAAAGAAGGATAAAGG + Intronic
1033150864 7:138913962-138913984 GAGGGGACAGAAAAGGAGGAGGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033646252 7:143306844-143306866 GAGGGGTAATAGAAAGCAGAAGG - Exonic
1033867146 7:145704707-145704729 GAAGGCAAATAGAAAGAGGATGG - Intergenic
1034453579 7:151151363-151151385 GAGGGGAAAGAACAGGCTGATGG - Intronic
1034596675 7:152201736-152201758 GAGGGGAAAAACATGTATGAAGG + Intronic
1034878918 7:154749067-154749089 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034878925 7:154749119-154749141 GACCGGAAAGAGAAGGATGGCGG + Intronic
1034879035 7:154749688-154749710 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034879044 7:154749740-154749762 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879053 7:154749792-154749814 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879071 7:154749895-154749917 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034879080 7:154749947-154749969 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879089 7:154749999-154750021 GACGGGAAAGAGAGGGATGGAGG + Intronic
1035850151 8:2910934-2910956 AAGGAGAAATGGAAGGATTATGG + Intergenic
1037449194 8:18999772-18999794 GAGGGGAGTTAGAAAGATAATGG - Intronic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037692457 8:21193762-21193784 GAGCTGAAAGAGAAGGAGGAAGG + Intergenic
1037745110 8:21637054-21637076 AAGGGTAAATGGAAGAATGAGGG - Intergenic
1038356269 8:26832045-26832067 GAGGGGGAAGAGAAGGCTGGTGG - Intronic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038498751 8:28025896-28025918 GAGGGGAACTGGAAGGCTGGAGG - Intronic
1039338279 8:36619049-36619071 GAGGGGAAGGGGAAGGATGGGGG + Intergenic
1039383794 8:37112123-37112145 GAGGGTAAATGGCAGGAGGAGGG + Intergenic
1039795174 8:40906688-40906710 GATGGGAAAGAAAAGAATGACGG + Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041539758 8:58970375-58970397 GGGGAGAAATAGAAGGAAGTGGG - Intronic
1041746155 8:61211340-61211362 GAGGGGGAAGAGAAGAAGGAGGG - Intronic
1043155051 8:76768480-76768502 AGGGGGAAAGAGAAAGATGAGGG + Intronic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043490646 8:80745450-80745472 GAGGGGAAATTTAACTATGAGGG + Intronic
1043657321 8:82685323-82685345 GAAGGGAAATAGAAGGATGAAGG + Intergenic
1043817697 8:84823412-84823434 GAGAGGAAATAAAAGGCTGCAGG + Intronic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1044860189 8:96515453-96515475 TATGGGAAATAGAAGGATGGAGG + Intronic
1045474635 8:102542557-102542579 GAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1045820165 8:106327978-106328000 GAGGGGAAACTAAAGGATGTGGG + Intronic
1045949970 8:107840568-107840590 GAAGGGAGAGAGAAAGATGAGGG - Intergenic
1046478249 8:114778368-114778390 GAGGGGAGAAGGAAGGATGGGGG + Intergenic
1046719596 8:117604386-117604408 GAGGGGACATAAAAGAATCAAGG + Intergenic
1047634914 8:126750949-126750971 GAGTGGAAATGGGAGGATGTTGG + Intergenic
1048045572 8:130769607-130769629 GATGGGAAACAGAAGTGTGAGGG + Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048249974 8:132856752-132856774 ATGGGGAAATTGGAGGATGATGG + Intergenic
1048512826 8:135078079-135078101 GAGGGCAGAGAGAAGGAAGAGGG - Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048545424 8:135382181-135382203 TAGGAGAAATAGCAGCATGAGGG + Intergenic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049317216 8:141975639-141975661 GAGGGGAAATGGAAGCACCATGG - Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1049755175 8:144308234-144308256 GAGGGGACATCGAAGGCTTAGGG - Intronic
1050194558 9:3067808-3067830 GAAAGGAAATATAAGGAAGATGG + Intergenic
1050273396 9:3970917-3970939 GAGGGGAAATAAAAAAAGGATGG + Intronic
1050416361 9:5421399-5421421 GAGGGGAAAAAGCAGGGTAAGGG - Intronic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051506656 9:17834544-17834566 GAGAGGAACTAAAAGGGTGAAGG + Intergenic
1051712382 9:19945302-19945324 GAGGGGAAAAGGAAGGAGGGAGG + Intergenic
1051903511 9:22068432-22068454 TAGGGGAAATTGAAGGATCAGGG + Intergenic
1052298111 9:26921454-26921476 GAGGGGAGATTAAAGTATGATGG - Intronic
1052901518 9:33798094-33798116 GGGGGGAAGTAGAAGGACAAAGG - Intronic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1054771299 9:69086599-69086621 AAGGGGAAATAAAGGGATGAGGG - Intronic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055087083 9:72325347-72325369 GGGGGGAAAAAAAATGATGAAGG - Intergenic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1056089193 9:83187743-83187765 GAGGAGAAATGGAAGGTAGAGGG - Intergenic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056289495 9:85128399-85128421 GATGGGAACTAGGAAGATGAAGG + Intergenic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1058320380 9:103622595-103622617 GAGGGGGAGAAGAAAGATGAGGG - Intergenic
1058557003 9:106179932-106179954 GAGGAAAAAAAGGAGGATGAGGG - Intergenic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059846036 9:118277861-118277883 GAGGAAAAGTATAAGGATGATGG + Intergenic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1060122895 9:121011964-121011986 GAAGGGTAGTAGGAGGATGAGGG + Intronic
1060477838 9:123999328-123999350 GAGGGGAGGTAGAAGGAAGCCGG + Intergenic
1060482095 9:124022634-124022656 GAGGTGACACAGAGGGATGACGG + Intronic
1061573735 9:131493386-131493408 GAGCGGAACTGGAAGGAGGAAGG + Intronic
1062163910 9:135096144-135096166 GAGGAGGAAGAGGAGGATGAAGG - Intronic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185708453 X:2282595-2282617 GAGGGGAGAGAGAAGAAAGAGGG + Intronic
1185872980 X:3680046-3680068 GAGGAGGGATAGATGGATGAGGG - Intronic
1185966470 X:4610683-4610705 GAAAGGAAAAAGAAGGAGGAAGG + Intergenic
1186560851 X:10611453-10611475 AAGGGCAAATTTAAGGATGATGG + Intronic
1186590120 X:10921408-10921430 GAGGAGAAATAAAAGGAGGGAGG - Intergenic
1186591305 X:10932539-10932561 AAGGGGAAATGAAAGGGTGAAGG + Intergenic
1187469655 X:19557672-19557694 GAGGGGAAATATCAAGATGCAGG - Intronic
1187772148 X:22711512-22711534 GAAGGGGAAGAGAGGGATGAGGG + Intergenic
1187890354 X:23928775-23928797 GAGGGGAAAGAGAGAGATAATGG - Intronic
1188403712 X:29780503-29780525 TCAGGGAAATAGAAGGCTGAGGG - Intronic
1189052823 X:37664293-37664315 GAGGGGAAATAGAAGTCTCATGG - Intronic
1189357623 X:40323440-40323462 GAGGAGGAATGGAAGGATAAGGG - Intergenic
1189921250 X:45905047-45905069 GAGGAGAAATAAATGGCTGAAGG - Intergenic
1190575507 X:51832607-51832629 GAGGGGAAAGAGAAGGGAAAAGG + Intronic
1190811002 X:53883375-53883397 GGGGGTAAATAAAAAGATGATGG - Intergenic
1191695927 X:63990205-63990227 GCGGGGGAATAGAAGGGTGGTGG + Intergenic
1191731212 X:64337624-64337646 CAGGGCAAAAAGAAAGATGAGGG + Intronic
1191767202 X:64710814-64710836 GCTGGGAAATAGGAAGATGATGG + Intergenic
1192373434 X:70534944-70534966 GAGAGGAAATGGAAGGATATTGG - Intronic
1193716226 X:84937409-84937431 AAGGGGAGATGGAGGGATGAAGG + Intergenic
1193998220 X:88392764-88392786 GAGGGGAAATGTAGGAATGAAGG + Intergenic
1194039045 X:88917030-88917052 AAGGGCTTATAGAAGGATGAAGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194940947 X:100009472-100009494 TAGGGAAAATAAAAAGATGAGGG - Intergenic
1196237531 X:113299952-113299974 GAGGGGAGATAGGAGGGGGAGGG - Intergenic
1196327913 X:114429776-114429798 TGGGGGAAATAGACGGATGTTGG + Intergenic
1196834502 X:119801986-119802008 GAAGGGAAAGAGAAGAAGGAAGG - Intergenic
1197354861 X:125425911-125425933 GTGGGGGAATTGAAGGAAGATGG + Intergenic
1197514380 X:127407159-127407181 GAGAGGAAATGGAAAGATGTAGG - Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197867230 X:131032255-131032277 GAGGGGAAATGGAGAGATGTTGG - Intergenic
1198323814 X:135546704-135546726 GAGGGGAATTCAAAGGAAGATGG - Exonic
1198428407 X:136542142-136542164 GAGGGGAGAGAGAAGGAGGCTGG - Intronic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1199850482 X:151722228-151722250 GAGGGAACATACAAGGATAAGGG + Intronic
1200692071 Y:6316374-6316396 GATGGGAAAATGAAGAATGAAGG + Intergenic
1200713645 Y:6512565-6512587 GATGGGAAAATGAAGAATGAAGG - Intergenic
1201020282 Y:9649476-9649498 GATGGGAAAATGAAGAATGAAGG + Intergenic
1201043201 Y:9858353-9858375 GATGGGAAAATGAAGAATGAAGG - Intergenic
1201697389 Y:16840952-16840974 AAGGAAAAATAGAAGGAAGAAGG + Intergenic
1202364579 Y:24148877-24148899 GAGGGGAAAATAAAGGTTGAGGG - Intergenic
1202379261 Y:24261494-24261516 GAGGGGCAGCAGAAGGGTGAAGG - Intergenic
1202491521 Y:25408627-25408649 GAGGGGCAGCAGAAGGGTGAAGG + Intergenic
1202506202 Y:25521245-25521267 GAGGGGAAAATAAAGGTTGAGGG + Intergenic