ID: 1094323670

View in Genome Browser
Species Human (GRCh38)
Location 12:29212989-29213011
Sequence AAACCTATCCTGTGACTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094323670_1094323671 18 Left 1094323670 12:29212989-29213011 CCACTAAGTCACAGGATAGGTTT 0: 1
1: 0
2: 1
3: 44
4: 110
Right 1094323671 12:29213030-29213052 AATTACAATAGCATAATAATTGG 0: 1
1: 0
2: 1
3: 44
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094323670 Original CRISPR AAACCTATCCTGTGACTTAG TGG (reversed) Intronic
904034905 1:27553282-27553304 ATACCAATCCTGTGAGGTAGGGG + Exonic
907776857 1:57524280-57524302 AATCCAATACAGTGACTTAGGGG + Intronic
909073247 1:71022438-71022460 AATCCCTTCCTGTGACATAGTGG + Intronic
909596390 1:77411402-77411424 AAACCTATCGTATGAGTTAGGGG - Intronic
911579357 1:99617432-99617454 ACACCTTTCCTGTAATTTAGGGG + Intergenic
911736048 1:101337693-101337715 AAACCTCTCCTGTGACTGGAGGG - Intergenic
912226598 1:107741337-107741359 ACACCCATCCTGGGATTTAGAGG - Intronic
913447573 1:118966204-118966226 GAACCAATCTTGTGACTTTGAGG + Intronic
916184743 1:162119964-162119986 GAACCTATCCTGTGAATAATAGG + Intronic
916972815 1:170042652-170042674 AAACTTGACCTGTGACTGAGTGG + Intronic
918162682 1:181915868-181915890 AAACCTATCATTGGATTTAGTGG + Intergenic
919956932 1:202426890-202426912 AAACCCAAACTGTGCCTTAGAGG + Intronic
920181555 1:204134980-204135002 AAGCCTAACCTCTGGCTTAGGGG - Intronic
921737121 1:218641586-218641608 AAATTTTTCCTCTGACTTAGAGG - Intergenic
924028721 1:239865783-239865805 GAGCCTATCCTGTTACTTATGGG + Intronic
924073092 1:240303399-240303421 AAAACTATCCTTTGACTATGAGG - Intronic
1063925046 10:10969311-10969333 ACCCCCAACCTGTGACTTAGTGG - Intergenic
1065562360 10:26976569-26976591 AAATCTATCCTCTGACCTAGAGG - Intergenic
1066795492 10:39115519-39115541 AAACCTTTCTTTTGACTCAGTGG + Intergenic
1066796660 10:39129458-39129480 AAACCTATCTTTTGATTAAGAGG + Intergenic
1066808791 10:39296558-39296580 AAACTTATCTTTTGACTGAGAGG - Intergenic
1074788864 10:116866105-116866127 AAACATATTCTGTGATTTGGGGG - Intronic
1075827660 10:125373476-125373498 AAACCTAAACTTTGACTCAGTGG - Intergenic
1077866476 11:6225749-6225771 AAACCTACCCAGTGACCTATGGG + Intronic
1078921866 11:15838156-15838178 GAAACTATGCTGTGACTTAATGG - Intergenic
1078922950 11:15847399-15847421 AAAATTGTCCTGTGACTTACAGG + Intergenic
1080255248 11:30282949-30282971 AAACCAAACCTGTGACTCATTGG + Intergenic
1080897189 11:36456412-36456434 AGACCTCTCCTGTGAGTGAGTGG + Intronic
1084515482 11:69636076-69636098 CAACCTAGCCTGTGTCTCAGGGG + Intergenic
1086617421 11:88838790-88838812 AAACCTATACTGTTAATAAGTGG - Intronic
1094323670 12:29212989-29213011 AAACCTATCCTGTGACTTAGTGG - Intronic
1094862555 12:34484894-34484916 AAACCTCTCCTTTGATTCAGAGG - Intergenic
1094862696 12:34487125-34487147 AAACCTTTCCTTTGATTCAGAGG - Intergenic
1095290708 12:40477197-40477219 ATACTTATCCTGTGATTTTGGGG - Intronic
1098223325 12:68293541-68293563 AACCCTATTCAGTGACTCAGGGG - Intronic
1098920709 12:76299714-76299736 AAACCTATGCTGTGGTTTGGTGG + Intergenic
1099488160 12:83253268-83253290 AAAACTTTCCTGAGTCTTAGGGG + Intergenic
1104852556 12:131884230-131884252 CATCCTTTCCTGTGACTGAGTGG - Intergenic
1105076067 13:16024895-16024917 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105076273 13:16028818-16028840 AAACCTTTCCTGTGATTGAACGG + Intergenic
1105076467 13:16032735-16032757 AAACCTTTCCTGTGACTGAGCGG + Intergenic
1105076853 13:16040572-16040594 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105077077 13:16044490-16044512 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105077276 13:16048404-16048426 GAACCTTTCCTGTGATTGAGTGG + Intergenic
1105077491 13:16052316-16052338 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105077688 13:16056231-16056253 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105077878 13:16059972-16059994 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105078079 13:16063887-16063909 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105078284 13:16067802-16067824 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105078483 13:16071549-16071571 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105078686 13:16075463-16075485 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105078873 13:16079206-16079228 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105079080 13:16083125-16083147 AAAACTTTCCTGTGATTGAGCGG + Intergenic
1105079274 13:16086867-16086889 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105079680 13:16094531-16094553 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105079876 13:16098273-16098295 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105080086 13:16102188-16102210 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1105080299 13:16106107-16106129 AAACCTTTCCTGTGATTGACCGG + Intergenic
1105080499 13:16110021-16110043 AAACCTTTCCTGTGATTGAGCGG + Intergenic
1108123653 13:47217140-47217162 TAACCTAGTCTGTTACTTAGAGG - Intergenic
1109030335 13:57181674-57181696 AAACCTATCCTATGGCTGAAAGG - Intergenic
1110114269 13:71792466-71792488 AAAAGTATCCTTTGACTTTGAGG - Intronic
1112642610 13:101293315-101293337 GAACCTACCCTGTGATTTACAGG - Intronic
1114916716 14:27276618-27276640 AAATAGATCCTGTGATTTAGTGG - Intergenic
1117715115 14:58572415-58572437 AGACATATCCTGTGACTTAAGGG + Intergenic
1120739601 14:88093253-88093275 AATCCTGTCCTGTGCCTAAGTGG + Intergenic
1121151363 14:91638134-91638156 AAACCTGCCCTTTGACTTAAAGG - Intronic
1123961991 15:25412728-25412750 AAACCTATCCAGTGTCCTAGAGG + Intronic
1128446819 15:67770032-67770054 AAAACTGTCTTGTCACTTAGTGG + Intronic
1132077916 15:98838422-98838444 AAAACTATTCTAGGACTTAGTGG + Intronic
1137878461 16:52020726-52020748 AGACATATTCTGTGACTTTGGGG - Intronic
1144363797 17:14522559-14522581 AAACCTATCCTCTAAGTCAGAGG + Intergenic
1151258522 17:72898517-72898539 AAACTTCTGCTGTGACATAGAGG + Intronic
1156059775 18:33060077-33060099 ATACCTATACTGAGTCTTAGAGG - Intronic
1162176077 19:8831683-8831705 AAAAATATCTTGTCACTTAGAGG + Intronic
1164337998 19:24351397-24351419 AAACCTTTCCTTTGATTTCGCGG + Intergenic
927401238 2:22713795-22713817 CAACCAAACCTATGACTTAGTGG - Intergenic
932117224 2:69063079-69063101 GAACCAGTCCTGTGACTTATGGG + Intronic
933989746 2:87625633-87625655 AAACCTCTCCTGTCACTGAGGGG + Intergenic
936304098 2:111325193-111325215 AAACCTCTCCTGTCACTGAGGGG - Intergenic
942332073 2:174836985-174837007 GAAGGTATCCTTTGACTTAGGGG - Intronic
942584351 2:177458484-177458506 CACCCTATCCTGAGACTTTGTGG - Intronic
947477038 2:230459610-230459632 CAAACTATCCTGAAACTTAGTGG + Intronic
1173799496 20:45886323-45886345 AAACCTATCTCCTGTCTTAGTGG + Intergenic
1174959416 20:55138235-55138257 TAACCCATCCTGTTCCTTAGGGG + Intergenic
1176531742 21:7970397-7970419 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176531938 21:7974312-7974334 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176532142 21:7978223-7978245 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176532354 21:7982306-7982328 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176532563 21:7986389-7986411 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176532776 21:7990473-7990495 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176532981 21:7994387-7994409 AAAACTTTCCTGTGATTGAGCGG - Intergenic
1176533199 21:7998635-7998657 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176533400 21:8002550-8002572 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176533609 21:8006465-8006487 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176533815 21:8010380-8010402 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176534020 21:8014290-8014312 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176534220 21:8018204-8018226 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176534534 21:8024500-8024522 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176534706 21:8027739-8027761 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176534880 21:8030978-8031000 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176535080 21:8034892-8034914 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176535279 21:8038806-8038828 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1176535470 21:8042546-8042568 AAACCTTTCCTGTGATTGAGCGG - Intergenic
1180582292 22:16849979-16850001 AGACCTATCTTATGAGTTAGAGG + Intergenic
1182183842 22:28380867-28380889 AAACTTTTCCAGTGACATAGTGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
951016968 3:17742354-17742376 AAACCTGTCCTGAGGCTGAGTGG + Intronic
951373645 3:21886274-21886296 ACATCTATACTATGACTTAGAGG - Intronic
951518954 3:23593462-23593484 AAACCTTTCCTTTGACTATGAGG + Intergenic
957158642 3:76579419-76579441 AAAACTGTCCTGTGACTTCATGG - Intronic
963087588 3:141452815-141452837 AAACCTATTCTGGTTCTTAGGGG - Intergenic
967286245 3:187873348-187873370 AAAACTATACTGAGACTTTGTGG - Intergenic
970514180 4:16811129-16811151 AAACCTGTGCTGTAACTCAGGGG - Intronic
979354904 4:119691674-119691696 TCACCTATCATGTGGCTTAGGGG + Intergenic
981246975 4:142552076-142552098 ACAGCTTTCCTGTGACTTTGTGG - Intronic
1202769191 4_GL000008v2_random:185459-185481 AAACCTTACCAGTGGCTTAGAGG - Intergenic
989771647 5:45153227-45153249 AAACATCTCCTGTGACTTACGGG - Intergenic
993871359 5:93258024-93258046 AAACCTCTCCTGTATCTCAGTGG - Intergenic
994062457 5:95495098-95495120 GAACCTTTCCAGTGATTTAGTGG - Intronic
997349402 5:133219769-133219791 TAACCTAACCTGTAACTTGGAGG - Intronic
1002647873 5:180670158-180670180 AAAACTAACCTTTCACTTAGGGG + Intergenic
1002828849 6:800215-800237 AAACATATCCTGTTACTTTAGGG + Intergenic
1003784428 6:9468491-9468513 AAACATATCCTGCTGCTTAGTGG + Intergenic
1011653581 6:89529700-89529722 AAACTTGTCCTTTCACTTAGAGG + Intronic
1012123565 6:95397930-95397952 AAAGCTAACCTCTGAATTAGAGG - Intergenic
1012489056 6:99759665-99759687 AAACTTAACTTGTTACTTAGAGG + Intergenic
1014289147 6:119538862-119538884 AAATCTACCCTGTGCCTCAGAGG + Intergenic
1014678271 6:124395604-124395626 AAACTTAGCATGTGAGTTAGAGG + Intronic
1018798521 6:167205620-167205642 GAACCTCTCCAGTGACTCAGAGG + Intergenic
1020457381 7:8389582-8389604 AAACGCATCCTGTAACTAAGTGG - Intergenic
1021299303 7:18952423-18952445 AAAGCTTCCCTGTGACTTTGGGG - Intronic
1024207269 7:47174605-47174627 TAACCTATCCTCTGCCTTATAGG - Intergenic
1024776372 7:52791809-52791831 AAACATCTCAAGTGACTTAGAGG + Intergenic
1025016899 7:55446950-55446972 ATAACTATCCTGTGACAAAGAGG - Intronic
1028036394 7:85989326-85989348 AAACCTATAATGTGACTTAATGG + Intergenic
1031286765 7:119880108-119880130 GAAGCTATCCTCTGGCTTAGAGG - Intergenic
1035299235 7:157886516-157886538 AATACTTTCCTGTGACTTAAAGG - Intronic
1037924666 8:22834795-22834817 GAAGCCATCCTGTGACTGAGAGG + Intronic
1038218302 8:25583559-25583581 CAACCTCTCCAGTGATTTAGGGG - Intergenic
1040124121 8:43717256-43717278 AAACCTTTCTTTTGATTTAGCGG + Intergenic
1040435613 8:47388101-47388123 AAACCTATACTGGGTCTCAGAGG - Intronic
1049828687 8:144686066-144686088 GGACCTACCCTGTGAGTTAGCGG + Intergenic
1054814942 9:69465869-69465891 AAACCTTGCCTGTGCCTCAGAGG - Intronic
1057323422 9:94035833-94035855 ACACCTATCTTTTGACTTACTGG + Intronic
1060259796 9:122064282-122064304 AAAACTTTCTTTTGACTTAGGGG + Intronic
1203401327 Un_KI270519v1:102861-102883 GAACCTTTCCTGTGATTGAGCGG + Intergenic
1203413872 Un_KI270589v1:29443-29465 AAACCTTTCCTTTGATTTAGCGG - Intergenic
1203684407 Un_KI270757v1:30435-30457 AAACCTTTCCTTTGATTTAGCGG + Intergenic
1186548569 X:10477796-10477818 AAACCTATCTTGTTACTGTGAGG - Intronic
1187821834 X:23296273-23296295 CAAACTATTCTGAGACTTAGTGG - Intergenic
1188745957 X:33844003-33844025 AAATATATCCTGTGAGTTAAGGG - Intergenic
1189818042 X:44844032-44844054 ACACCTAGCCTGAGACTTGGCGG + Exonic
1191578505 X:62733961-62733983 AAACCTTTCCTTTGACTCCGAGG - Intergenic
1201643175 Y:16200312-16200334 AAAACTATCCTATGAGTCAGCGG + Intergenic
1201659640 Y:16385009-16385031 AAAACTATCCTATGAGTCAGCGG - Intergenic