ID: 1094324289

View in Genome Browser
Species Human (GRCh38)
Location 12:29220006-29220028
Sequence TCAAGGAATTTTAGAGCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 6, 3: 28, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094324289 Original CRISPR TCAAGGAATTTTAGAGCTAG TGG Intronic
902095152 1:13937637-13937659 TCAAGGATTTTTAGAGTTTCAGG + Intergenic
905277354 1:36827095-36827117 TCATGGAAGTTTAGAGATGGAGG - Intronic
906333755 1:44910203-44910225 AGCAGGAATTTTAGAGCTGGAGG + Intronic
907627574 1:56045163-56045185 GCAATGAATTTCAGAGCTTGGGG - Intergenic
907660237 1:56385067-56385089 ACAAGGAATTTAGGAGCTGGTGG + Intergenic
907709219 1:56862898-56862920 TGAAGGGATTTTAGAGCTTATGG - Intronic
908247056 1:62235710-62235732 TAAATGAATTTTAGAGCTGAGGG + Intergenic
908926107 1:69257038-69257060 TCAAGGACTTTAACAGCAAGAGG - Intergenic
909940611 1:81607354-81607376 TCATGGAATTTTTAATCTAGTGG + Intronic
910560836 1:88589053-88589075 GCAAGTATTATTAGAGCTAGAGG + Intergenic
911885859 1:103298602-103298624 TTACAGAATTTTAGAGCTATAGG + Intergenic
913314010 1:117534893-117534915 TCAAGGCCTTTAAGAGCTACAGG - Intergenic
913443882 1:118928915-118928937 TCACAGAATTTTAAAGCAAGGGG - Intronic
915129594 1:153687517-153687539 TCACAGAGTGTTAGAGCTAGAGG - Intronic
915775322 1:158478185-158478207 TCTAGGATTTTTAGAGTTTGAGG - Intergenic
915989474 1:160499171-160499193 TCTAGGATTTTTATAGCTTGAGG + Intronic
916260363 1:162835844-162835866 TAAAGAAATTTCAGAGCAAGGGG - Intronic
916675877 1:167064020-167064042 TCATGGGATTTTAAAGATAGCGG + Intronic
917580233 1:176369697-176369719 TCAAGGAATACTAAAACTAGTGG + Intergenic
919098741 1:193067760-193067782 TCTAGGAGTTTTAGAGCTAATGG + Intronic
920989237 1:210920852-210920874 TCAAGGAACCTAAAAGCTAGAGG + Intronic
921007164 1:211105441-211105463 TAAAGGAAATTTAGAACTACTGG - Intronic
921040910 1:211431041-211431063 ACAAACAATTTTATAGCTAGAGG - Intergenic
924130911 1:240907125-240907147 TCATGGAATGTCAGAGCTGGAGG - Intronic
924536970 1:244943787-244943809 TGAAGGTATTTTAGAGTTTGAGG - Intergenic
1063201567 10:3788910-3788932 TCAAGCAATTTGAGAGGCAGAGG - Intergenic
1064845755 10:19651002-19651024 ACAAGGGATTCTAGAGATAGTGG - Intronic
1065306709 10:24375967-24375989 TAAAAGAAAGTTAGAGCTAGAGG - Intronic
1065480898 10:26192990-26193012 TCTAGGACTTTGAGAGCTAAGGG - Intronic
1066618237 10:37317939-37317961 TCAAGGAGTTTTAGAACTTGGGG - Intronic
1068242540 10:54322743-54322765 TCTAGGATTTTTATAGCTTGAGG - Intronic
1069328757 10:67264725-67264747 TCATGAAATGTTAGAGATAGAGG + Intronic
1069666393 10:70163380-70163402 TCTAGGACTTTCATAGCTAGAGG + Intronic
1070381690 10:75885876-75885898 TCAAGGAACTTGAGACCTAGTGG - Intronic
1071768600 10:88698906-88698928 TTATGGAATTTTAGAGCTCCTGG - Intergenic
1071861509 10:89678478-89678500 TCAATGAATTCTAAAACTAGTGG + Intergenic
1074306686 10:112285583-112285605 TCACAGAATATTAGAGCTGGAGG - Intronic
1077631336 11:3813042-3813064 GGAAGACATTTTAGAGCTAGCGG - Intronic
1077938083 11:6811854-6811876 AGAAGGAATTTCAGAGCTTGAGG - Intergenic
1078567082 11:12425442-12425464 TCAAGGTATTTTGGGGTTAGGGG - Intronic
1079610126 11:22422443-22422465 TGATTCAATTTTAGAGCTAGAGG - Intergenic
1079724132 11:23858820-23858842 TCTAGGACTTGTAGAGCTTGAGG - Intergenic
1080215965 11:29840971-29840993 CCTAGGATTTTTAGAGCTAGAGG + Intergenic
1080709098 11:34729117-34729139 TCCAGGATTTTTATAGCTTGAGG + Intergenic
1082753971 11:57053605-57053627 TCAAGTAATTTTAAATCTAGTGG - Intergenic
1085140229 11:74133686-74133708 TCAAGGAATTCTCAAGCTAATGG - Intronic
1085737800 11:79054423-79054445 TCATGGAGTTTTTGAGCTAAGGG + Intronic
1085844954 11:80054618-80054640 TTAAGGAATTTAAGAGAGAGAGG + Intergenic
1086237356 11:84647625-84647647 TCAAGGAATTTATGATCTAATGG - Intronic
1088127430 11:106445811-106445833 TCAAGGAATTTTGCTGCTAATGG + Intergenic
1088924972 11:114292852-114292874 CCAGGGAATTTTAGACATAGTGG - Intronic
1089043710 11:115480494-115480516 TCATGGAAATTTAGAGCTGAAGG - Intronic
1089179208 11:116569379-116569401 CCAAGCAATTTCTGAGCTAGGGG + Intergenic
1090251601 11:125255569-125255591 TCAAGGAATTTCTGTGTTAGTGG + Intronic
1092643283 12:10540466-10540488 TCTAGGATTTTTATAGCTTGAGG - Intergenic
1092836340 12:12492638-12492660 TCAAGGAATTTCAAAGATATGGG - Intronic
1092906825 12:13108250-13108272 TCTAGGATTTTTATAGCTCGAGG + Intronic
1094324289 12:29220006-29220028 TCAAGGAATTTTAGAGCTAGTGG + Intronic
1095625477 12:44309162-44309184 TCATGAAATTTTAGAGCAGGAGG + Intronic
1096539441 12:52296749-52296771 TGAAGGAAGTTGAGAGGTAGTGG - Intronic
1098532081 12:71552852-71552874 CCATGGAATTTTAGAGCCAGAGG + Intronic
1098863758 12:75738945-75738967 TGAATGAATTATAGAACTAGTGG - Intergenic
1099721235 12:86364408-86364430 TCCAGGATTTTTAGAGTTTGAGG + Intronic
1101526229 12:105533697-105533719 TCATGGAACTTATGAGCTAGTGG - Intergenic
1102068939 12:110001259-110001281 TCAAGAAATTGTAGAGGAAGAGG + Intronic
1104409760 12:128548189-128548211 TCAAGCAATTTTAGGGATTGGGG - Intronic
1106455531 13:29923590-29923612 TCAAGGCATTTTGGGGCTTGTGG - Intergenic
1106569011 13:30909966-30909988 TGAAGGAGCTTTAGAGCTGGTGG - Intronic
1106675187 13:31950937-31950959 TCAAGGAACTGTAGAGATGGGGG + Intergenic
1108195929 13:47994659-47994681 ACAAGGAAATTTAAATCTAGAGG - Intronic
1108473873 13:50793962-50793984 TCTAGGATTTTTAGAGGTTGAGG + Intronic
1108488846 13:50958202-50958224 TCTAGGATTTTTATAGCTTGAGG + Intronic
1110429070 13:75402284-75402306 TCAAAGTAATTTAGAGCTTGTGG + Intronic
1112653382 13:101422350-101422372 TCTAGGACTTTTATAGCTAGAGG - Intergenic
1112714035 13:102163457-102163479 TCGAGGAAGTTTAGAGCAAGTGG + Intronic
1112912091 13:104499199-104499221 TCAAAGAATTTCATAGCTAGAGG - Intergenic
1114127301 14:19743876-19743898 TCAAGGAATTCTAGGGCTAGTGG + Intronic
1114864170 14:26567544-26567566 TCCAGCAATTTGAGAGCTTGAGG - Intronic
1114986359 14:28234109-28234131 GCAAGTAATGTAAGAGCTAGAGG + Intergenic
1115146498 14:30232469-30232491 TCATGGAATTTTAAAACTAGAGG + Intergenic
1116089642 14:40288704-40288726 TCTAGGATTTTTATAGTTAGAGG + Intergenic
1116191089 14:41667679-41667701 TCAAAGAATTTTATAGATAGAGG - Intronic
1116493218 14:45530386-45530408 TCTAGGATTTTTATAGCTTGAGG - Intergenic
1117013627 14:51495746-51495768 TAAAGGAATTGGAGAGGTAGAGG + Intronic
1117385825 14:55211691-55211713 TCAAGACATTTTACAGCTAGTGG + Intergenic
1117538799 14:56726917-56726939 ACAACAAATTTTAGAGCAAGAGG - Intronic
1118375384 14:65172333-65172355 TCAAGGGATGTTAAAACTAGTGG + Intergenic
1120617919 14:86731280-86731302 TCAGGTAATTTTGGAGCTTGGGG - Intergenic
1121182750 14:91941930-91941952 ACAAAGAATTTTAGACCTTGCGG - Intronic
1123570757 15:21605522-21605544 TCAAGGAATTCTAGGGCTAGTGG + Intergenic
1123606870 15:22040875-22040897 TCAAGGAATTCTAGGGCTAGTGG + Intergenic
1124383872 15:29190202-29190224 TCACAGAATTGTAGAGCCAGAGG - Intronic
1125246278 15:37644924-37644946 TAAAAGAGTTTTAGAGCTACAGG + Intergenic
1125351017 15:38767631-38767653 TCATAGAATTTCAGAGCTAAAGG - Intergenic
1125564883 15:40669346-40669368 TCAAGCAATCCTACAGCTAGGGG - Intergenic
1126024900 15:44436259-44436281 CCAGAGAATTTTAGAGCTGGAGG + Intronic
1126342935 15:47663579-47663601 TCATAGAATATTAGAACTAGAGG + Intronic
1127892119 15:63262105-63262127 TGAAGACATTTTAGAGCTATAGG + Intronic
1129810946 15:78509229-78509251 GCATGGAATACTAGAGCTAGAGG + Intronic
1202979110 15_KI270727v1_random:332645-332667 TCAAGGAATTCTAGGGCTAGTGG + Intergenic
1133013250 16:2926231-2926253 ACAAGGAACTTTAGATCTAAAGG + Intronic
1133036002 16:3034787-3034809 CCCAGGAATTTTAGAGTTTGAGG - Intronic
1133367621 16:5223396-5223418 TCAAGGAAGCTTATAGCAAGAGG + Intergenic
1138566845 16:57839811-57839833 TGATGGAATTTTAGATCCAGGGG - Intronic
1141294465 16:82753995-82754017 TCACGGAATGCTAGACCTAGAGG - Intronic
1141375682 16:83527920-83527942 TCAAACAATATTAGAGCCAGAGG + Intronic
1142917666 17:3155208-3155230 TCAGGGAATTTTCGATCTAATGG + Intergenic
1144324524 17:14166199-14166221 TCTAGGACTTTGATAGCTAGAGG + Intronic
1145875153 17:28313745-28313767 TCAAGGAATCTACGATCTAGTGG + Intergenic
1149431638 17:56598689-56598711 TCTTGGAATGTCAGAGCTAGAGG + Intergenic
1149435904 17:56633150-56633172 GCAAGGACTTTTAGTGTTAGAGG - Intergenic
1150832669 17:68538061-68538083 TCAAGGAGATTTAAAGCTAATGG + Intronic
1150970547 17:70022122-70022144 TCATAGAATGTTAGAGCTGGAGG - Intergenic
1151296352 17:73189275-73189297 TCAAGGACTTCTAGAGCCAGGGG + Intergenic
1151949288 17:77340676-77340698 TCTAGGATTTTCATAGCTAGAGG - Intronic
1154983994 18:21530781-21530803 TCAAGGAATATCAGAGTTAATGG + Intronic
1155895658 18:31323049-31323071 TCATAGAATTTTAGGACTAGAGG + Intronic
1156096337 18:33537046-33537068 TCTAGGATTTTTACAGCTTGGGG - Intergenic
1156390392 18:36644898-36644920 TCAAGGAATTTTGGAGGGAGGGG + Intronic
1157063884 18:44324551-44324573 TCAAGGAATTTTACAGCCCTAGG - Intergenic
1157729706 18:49992855-49992877 TCCAGAAAGTTCAGAGCTAGTGG - Intronic
1158219603 18:55136586-55136608 TCACGGGATGTTAGAGCGAGTGG - Intergenic
926125369 2:10268388-10268410 TCACGGAATCTTACAGCCAGGGG - Intergenic
926191572 2:10732112-10732134 TCACAGAATTTCAGAGCTAAAGG - Intronic
926577910 2:14602551-14602573 TCAAGGAATTCTAGTCCCAGGGG - Intergenic
926959047 2:18333296-18333318 TCTAGGAATTTTACAGTTTGAGG - Intronic
927317813 2:21706043-21706065 TCAAGGAAATTTATAGCAAGAGG - Intergenic
927639003 2:24835055-24835077 GAAAGGGATTTTAGAGCTGGAGG - Intronic
927778330 2:25919335-25919357 TCAATGAATGTTAAAACTAGTGG + Intergenic
930360377 2:50370547-50370569 TCAAGGTATTTACTAGCTAGTGG - Intronic
930507213 2:52298510-52298532 TCTAGGAATTTTATAGCTAGAGG + Intergenic
930520086 2:52454699-52454721 TCAATGAATCTTAGAGCAAAAGG + Intergenic
931498068 2:62833427-62833449 TCTAGGAATTTCACAGCTAGAGG + Intronic
933304748 2:80583340-80583362 GCAAGGAATTTTTGAAATAGGGG - Intronic
933368046 2:81379656-81379678 GAAAGTAATTTCAGAGCTAGGGG - Intergenic
933375965 2:81480281-81480303 TCAAGGAGTTTTAGAGTTTTAGG + Intergenic
935321269 2:101891554-101891576 ACAAGGAATTCTGGAGCTGGAGG - Intronic
935754141 2:106264067-106264089 GGAAGGAATTTTAGAGTTTGTGG + Intergenic
936383562 2:112009356-112009378 TCATGGAATCTGAGAGCCAGAGG - Intronic
937966061 2:127511974-127511996 TCAAGTAATGTTGGAGCTAAAGG + Intronic
939122897 2:138139281-138139303 TTAAGAAATTTTAGAGCCACTGG + Intergenic
939797241 2:146660540-146660562 TAAATGAATTTTAAAGGTAGGGG + Intergenic
939937992 2:148315320-148315342 TCAAGGAAATATTGAGCTTGTGG - Intronic
940049130 2:149442571-149442593 TCAAAGCATTGTAGAGCAAGCGG - Intronic
940283958 2:152015077-152015099 TCACAGAATTTTAGAGCTGGAGG - Intronic
940610933 2:155990821-155990843 TCTAGGAATTTTATAGCTTTAGG + Intergenic
940618849 2:156084871-156084893 ACAAGGAATTTTACAGCTAAAGG - Intergenic
941986985 2:171519916-171519938 TCAGGGAAATTTAGAGGCAGTGG + Intergenic
942101664 2:172589917-172589939 TTAAGGAACTTAAGAGCAAGAGG + Intronic
942865692 2:180671822-180671844 TCTAGGAATTTTATAGTTTGAGG + Intergenic
943184460 2:184588673-184588695 TGAAGGCATTTTAAAGGTAGTGG - Intergenic
943292875 2:186097677-186097699 TCTAGGACTTTCATAGCTAGAGG + Intergenic
943897965 2:193391721-193391743 TCTAGGATTTTTATAGCTTGAGG + Intergenic
944338548 2:198567001-198567023 TCTAGGACTTTCATAGCTAGAGG + Intronic
944488156 2:200228340-200228362 TCAATAAATTTTATAGCTAGGGG + Intergenic
945189378 2:207170513-207170535 TCTAGGACTTTCATAGCTAGAGG + Intergenic
945422602 2:209657877-209657899 TCTAGGATTTTTATAGCTTGAGG + Intronic
945657764 2:212645994-212646016 TCAAGGAATTTATAACCTAGAGG - Intergenic
946663175 2:222022427-222022449 TCTAGGATTTTTATAGCTTGAGG - Intergenic
947674368 2:231963700-231963722 TCTAGGATTTTTATAGCTTGAGG + Intronic
1169304254 20:4474655-4474677 CCAAGGAATTTTAGAGGGAATGG - Intergenic
1169721325 20:8679962-8679984 TCATAGACTTTTAGAGCTAGAGG + Intronic
1169843952 20:9969854-9969876 TCAAGGAGTTTTTGGTCTAGTGG + Intergenic
1171428626 20:25064544-25064566 TCTTGGAATTTTAGAGCTCAAGG - Intergenic
1172361321 20:34314630-34314652 TCAAGGAATTTCCTAGCCAGTGG + Intergenic
1175164311 20:57032456-57032478 TCCAAGCATTTTAGAGCTACCGG + Intergenic
1176402795 21:6329818-6329840 GCTAGGAATTTTACAGCTATAGG + Intergenic
1176434362 21:6659286-6659308 GCTAGGAATTTTACAGCTATAGG - Intergenic
1176458624 21:6986356-6986378 GCTAGGAATTTTACAGCTATAGG - Intergenic
1176726854 21:10443658-10443680 TCAATTAATTTTTGAGCAAGGGG - Intergenic
1177270069 21:18836229-18836251 TCTAGGATTTTTATAGCTTGCGG + Intergenic
1177613393 21:23484324-23484346 TCTAGGAATTTTAGAGTTTCTGG - Intergenic
1178192561 21:30301423-30301445 TCATGAAATTATAAAGCTAGGGG + Intergenic
1179285661 21:39975484-39975506 TCAGAGAATTTCAGAGCTATGGG - Intergenic
1180287536 22:10763423-10763445 TCAATTAATTTTTGAGCAAGGGG + Intergenic
1180662018 22:17475909-17475931 ACAAGGAATTCTAGTGGTAGAGG - Intronic
1183001214 22:34861038-34861060 CCAAAGTATTTTAAAGCTAGTGG + Intergenic
949124100 3:424852-424874 TCATAGACTTTTAGATCTAGAGG + Intergenic
949234970 3:1797641-1797663 TAGAGAATTTTTAGAGCTAGAGG - Intergenic
950008964 3:9708950-9708972 TCAAGGAGTTTTACAGCAAAGGG + Intronic
950060186 3:10064578-10064600 TTTAGGAATTTTGGAGCTAAGGG - Intronic
950301553 3:11883801-11883823 TTTAGGAATTTTGGAGCTAAGGG - Intergenic
950608094 3:14102406-14102428 TCTAGGAATTTTACAGTTAGAGG - Intergenic
953547336 3:43873091-43873113 TGGAGGAATTCAAGAGCTAGAGG - Intergenic
955464340 3:59220809-59220831 TCTAGGAATTTTACAGTTCGGGG + Intergenic
955662696 3:61318023-61318045 GCAAGGAATTTTAAAGTCAGGGG - Intergenic
957146141 3:76426276-76426298 ACATTGAATTTTAAAGCTAGAGG - Intronic
957736018 3:84203662-84203684 TCCAGGGATTTTATAGTTAGGGG - Intergenic
957956868 3:87198225-87198247 TCAAGGAATTTAAGAACCTGGGG + Intergenic
957973676 3:87416081-87416103 TCTAGGATTTTTATAGCTTGAGG - Intergenic
958618182 3:96523457-96523479 TCTAGGATTTTTAGAGTTTGAGG + Intergenic
960178129 3:114541544-114541566 TCAAGGATTTTTAGAGGAAATGG - Intronic
960314439 3:116159135-116159157 TCAAGGATTTTTATAGCTTTAGG - Intronic
960839800 3:121945483-121945505 TCAAGGAATGGTTGAGCTTGGGG + Intergenic
962299151 3:134222237-134222259 TCAAGAAATTTTAGAGGAATAGG + Intronic
963295510 3:143541753-143541775 TCAAAGAAGTTCAGAGCTAAGGG - Intronic
963666469 3:148194495-148194517 TCATGTAATTTTAGAGGTAGAGG - Intergenic
963758162 3:149258098-149258120 TCATAGAATTTTACAGCCAGGGG + Intergenic
963824600 3:149938421-149938443 TCCAGGACTTTTGGAGCTGGTGG - Intronic
964075462 3:152686606-152686628 TCTAGGAATTTTAAAGATGGTGG + Intergenic
964548432 3:157860435-157860457 TCAAGGAATGGTAGAGCTAGGGG - Intergenic
964717801 3:159741057-159741079 TCAGGGAGCTTAAGAGCTAGTGG - Intronic
964812981 3:160685602-160685624 TCAAGGAATTATAGATTTAGGGG - Intergenic
965597172 3:170420572-170420594 TCAAGGAATTTAAAACGTAGTGG - Intronic
966320054 3:178692355-178692377 TCAAGGAATTTTATAGTTTTGGG + Intronic
966492644 3:180545435-180545457 TCTAGGATTTTTATAGCTTGAGG + Intergenic
966863430 3:184243045-184243067 TCAAGGAATGGCAGAGCCAGAGG - Intronic
967680598 3:192358269-192358291 TTAATTAATTTTAAAGCTAGTGG + Intronic
968720357 4:2198010-2198032 TCACAGAATTTTAGAGCAGGCGG - Intronic
969856635 4:10005108-10005130 TCAAGGAGTTCAAGATCTAGTGG + Intronic
970672358 4:18411542-18411564 TCATAGAATTTTAGACCTGGAGG + Intergenic
972406009 4:38747480-38747502 CCAAGGTATTTTAGAGACAGAGG + Intergenic
973126148 4:46587429-46587451 TCCAGGAATTATAGAGCTTAGGG + Intergenic
973129393 4:46631629-46631651 TCTAGGGATTTTAGAGCTTCAGG + Intergenic
974497259 4:62648120-62648142 TCTAGGATTTTTATAGCTACAGG + Intergenic
975499595 4:75070021-75070043 TCAAAGAATTTAAAATCTAGCGG - Intergenic
976415408 4:84768340-84768362 TCTAGGACTTTCATAGCTAGAGG + Intronic
977517558 4:98040430-98040452 TCTAGGATTTTTAGAGCTTCAGG + Intronic
977712637 4:100145385-100145407 TAAAGGCATTTTAGAGCTCTTGG + Intergenic
978003863 4:103592456-103592478 TTCAGGAATTTTAGGCCTAGTGG - Intronic
980117547 4:128693901-128693923 TCTAGGAATTTTATAGCTTTTGG - Intergenic
980491095 4:133530828-133530850 TAAAGGAATTTTAGCACTAGTGG - Intergenic
981072558 4:140559172-140559194 TCACATAATTTTAGAGCTGGAGG - Intergenic
982390956 4:154863204-154863226 TCAAGGCATTTCAGAGATTGAGG - Intergenic
982722437 4:158872333-158872355 TAAAAGAATTATAGAGCCAGAGG - Intronic
983043229 4:162954978-162955000 TTAAGGACTTTAAGAGCTAAAGG + Intergenic
983279958 4:165667877-165667899 TCAAGGAATTTTCTAACCAGAGG - Intergenic
983537733 4:168876227-168876249 ATAATGGATTTTAGAGCTAGTGG + Intronic
983801516 4:171935784-171935806 CCCAGGAATTTTCAAGCTAGTGG - Intronic
984171317 4:176362634-176362656 TCAAGTAATTTTAGATTCAGGGG + Intergenic
984474392 4:180217294-180217316 TGGAGGAGTTTTAAAGCTAGAGG - Intergenic
984971874 4:185198943-185198965 TCTAGGATTTTCATAGCTAGAGG + Intronic
985093523 4:186388992-186389014 TCTAGGATTTTTATAGCTTGAGG - Intergenic
985342436 4:188969443-188969465 TCCAGGAATTTTAAAGCCAAGGG + Intergenic
985970533 5:3374717-3374739 TCAAGGCATTGTACAGCAAGTGG + Intergenic
986822200 5:11480120-11480142 TCCAGGATTTTTATAGCTTGGGG + Intronic
987137768 5:14915896-14915918 TCATGGAGTTTTAGAGCCGGAGG + Intergenic
988248588 5:28723654-28723676 TCAAGGAATTTTACTGTAAGAGG - Intergenic
989435591 5:41409643-41409665 TCATGGAATTTAAATGCTAGTGG - Intronic
990975580 5:61558379-61558401 TCCAAGTATTTTAGAGCTGGAGG + Intergenic
991502530 5:67291180-67291202 TCAAGGACTGTAAGAGTTAGAGG - Intergenic
992014795 5:72564961-72564983 TGAATGACTATTAGAGCTAGAGG + Intergenic
992022860 5:72641777-72641799 TCCATGCATTTTAGAGCTTGAGG + Intergenic
992093076 5:73336621-73336643 TCAAGGAATTTTCAGTCTAGTGG - Intergenic
992678169 5:79126607-79126629 ATAAAGAATTTGAGAGCTAGAGG - Intronic
994281954 5:97915349-97915371 TCAAGGAGCTTATGAGCTAGTGG + Intergenic
994317983 5:98356719-98356741 TTAAGGAATTTTAGATTTTGTGG + Intergenic
994607812 5:101992559-101992581 TCAAGGAATTTTAACGTAAGAGG + Intergenic
995001562 5:107137320-107137342 TCCAGGACTTTAATAGCTAGAGG - Intergenic
995791097 5:115888069-115888091 TCAAGGAATTCAAAAGCTGGTGG - Intronic
1000090665 5:157927129-157927151 TCAAGGGATCTGAGAGCTGGAGG - Intergenic
1000892519 5:166816499-166816521 TCACCGAGTTTTAGAGCTCGGGG - Intergenic
1002992732 6:2252834-2252856 CCTAGAAATTTTAGAGCTATTGG - Intergenic
1003709196 6:8569868-8569890 AAAAGGAATTTTAAAGCAAGTGG + Intergenic
1003952453 6:11128600-11128622 TCTAGGAATTTTAGTCCTTGTGG + Intronic
1005734850 6:28735995-28736017 TCAAGGAATTTTACAGTTTAGGG - Intergenic
1006875759 6:37294481-37294503 TCTAGGACTTTCATAGCTAGAGG + Intronic
1007121588 6:39386720-39386742 TCATGGAATTTTAGAGACGGAGG - Intronic
1007999877 6:46349243-46349265 TGAAGCAATTTTAAATCTAGAGG + Intronic
1008297713 6:49798281-49798303 TACAGAAATTTTTGAGCTAGGGG - Intergenic
1008925434 6:56887226-56887248 TCAAAGAATGTTAAAGCTTGAGG - Intronic
1009989011 6:70818091-70818113 TCAAGTAATTTTAGAGTTTCTGG + Intronic
1010194516 6:73225719-73225741 TCAAAGAATTTTGGAGCAGGGGG + Intronic
1010608413 6:77921079-77921101 TCTAGGAATTTTGTAGCTACAGG - Intronic
1010724537 6:79318290-79318312 TCTAGGACTTTCATAGCTAGAGG - Intergenic
1012442441 6:99273523-99273545 TCAAGGCATTCTAGATCAAGTGG + Exonic
1013321801 6:108999170-108999192 TCAAGGAATTTTTAAGATAGTGG + Intronic
1013711094 6:112900123-112900145 TCTAGGAATTTTACAGCTTCAGG + Intergenic
1013753147 6:113430342-113430364 TCAATGAATTTAACATCTAGTGG - Intergenic
1013942345 6:115679921-115679943 TCATAGAATGTTAGAGCTGGAGG - Intergenic
1014592563 6:123292053-123292075 AGAAGGAATTTTGGGGCTAGTGG + Intronic
1015012022 6:128360835-128360857 AAAAGGAATTTTAATGCTAGCGG - Intronic
1016273405 6:142318497-142318519 TTAAGGAATTTTAGTGTTATTGG + Intronic
1016662941 6:146602310-146602332 TCATGGAAGTTTAGAACTGGAGG - Intronic
1020490274 7:8774015-8774037 TCTAGGATTTTTATAGCTTGAGG + Intergenic
1021181442 7:17510346-17510368 GCAAGGAATTTTATAGCCAGGGG - Intergenic
1021381178 7:19968286-19968308 TTTAGGAATTTTAAAGTTAGTGG - Intergenic
1021774594 7:24040248-24040270 TCATGGAACTTATGAGCTAGTGG + Intergenic
1022527549 7:31048323-31048345 TCAAGGATTTCTAGAGCTCTTGG + Intergenic
1022749266 7:33206220-33206242 TGAAGGGATTTTAAAGCAAGGGG + Intronic
1023053527 7:36273678-36273700 TCATGCACTTTTAGAACTAGAGG + Intronic
1024317095 7:48031016-48031038 TCTAGGAATTTTATGGTTAGAGG - Intergenic
1024492118 7:49997391-49997413 TGAATGAATGTTAGAGCTATGGG - Intronic
1024983574 7:55177582-55177604 TTAAGGAGTTCAAGAGCTAGTGG + Intronic
1025603504 7:63022531-63022553 TCACCCAATTTTAGAGATAGGGG - Intergenic
1026834541 7:73629417-73629439 TCAAGGAATTTGCCATCTAGTGG - Intergenic
1027401546 7:77813805-77813827 TAAAAGAATGTTAGAGGTAGTGG + Intronic
1028525178 7:91776281-91776303 TCAAAGAATTTAAGAGGCAGTGG - Intronic
1028618804 7:92801433-92801455 ACATAGAATTTTAAAGCTAGAGG + Intronic
1030757766 7:113309733-113309755 TCATTGAATTTTACAGCTGGAGG - Intergenic
1031133373 7:117859248-117859270 TCAAGGAATGTTAGAATTACAGG - Intronic
1034201588 7:149286008-149286030 TCAGGGAATTTTAGAAAGAGTGG - Intronic
1038424667 8:27457146-27457168 TCTAGGACTTTCATAGCTAGAGG + Intronic
1038658213 8:29473540-29473562 TGAAAGAATTTTAAGGCTAGTGG + Intergenic
1038837131 8:31138270-31138292 TCATAGAATTTCAGAGCTGGAGG - Intronic
1039163213 8:34645978-34646000 TCAAGAAATTTTAAACCTAATGG + Intergenic
1039656684 8:39417122-39417144 TCAAGTAATTTTAAAACTATGGG - Intergenic
1040843193 8:51806519-51806541 TCAAGGATTTTTAGCCCCAGAGG + Intronic
1041290865 8:56307327-56307349 TCAAGGTATTTAAGAGGTGGAGG - Intronic
1041545929 8:59042356-59042378 TCAAAGACTTTTACAGCCAGAGG + Intronic
1042390010 8:68223251-68223273 TGAAGTAATTTTACAGTTAGAGG - Intronic
1042575043 8:70208522-70208544 TCTAGGACTTTCATAGCTAGAGG + Intronic
1043294263 8:78644772-78644794 TCAAGGAACATTAGAGTTATGGG + Intergenic
1044046142 8:87434925-87434947 CCAACGAATTTAAGAGCTAGTGG - Intronic
1046138500 8:110061239-110061261 TCAAGGAATTTCTGAACCAGAGG + Intergenic
1046534637 8:115493225-115493247 TCATGGAAGTTAAAAGCTAGTGG - Intronic
1046548758 8:115685201-115685223 ACAAGGAAGTCTAGAGCTACTGG - Intronic
1047364337 8:124198407-124198429 CATAGAAATTTTAGAGCTAGAGG + Intergenic
1049136687 8:140908492-140908514 TCTAGGACTTTGACAGCTAGAGG + Intronic
1049314244 8:141951953-141951975 TCTAGGACTTTCACAGCTAGAGG + Intergenic
1051159149 9:14186159-14186181 TCATAGAATTTTAGAGCCACAGG - Intronic
1051305335 9:15702612-15702634 CCTAGGACTTTTACAGCTAGAGG - Intronic
1053009526 9:34625249-34625271 TCCAGGAATGTCAGAGCTGGAGG - Intronic
1053103479 9:35390830-35390852 TAAAGGAATTCTAGGCCTAGTGG + Intronic
1053182201 9:35982349-35982371 TCTAGGACTTTTAGAGCTGGTGG - Intergenic
1053319713 9:37085285-37085307 TCAAGTATTTATAGAGGTAGAGG + Intergenic
1054770546 9:69079268-69079290 TAAAGGAATTTTTGAGGAAGTGG - Intronic
1055292838 9:74801567-74801589 TCAAAGACTTCTAGAGTTAGGGG + Intronic
1055819398 9:80243828-80243850 CCACTGAATTTTAGAGCTTGAGG + Intergenic
1056569208 9:87800935-87800957 TCAATGCATTTCACAGCTAGAGG - Intergenic
1061494697 9:130965773-130965795 TCTAGGACTTTCATAGCTAGAGG + Intergenic
1203437173 Un_GL000195v1:149359-149381 GCTAGGAATTTTACAGCTATAGG + Intergenic
1186322648 X:8446456-8446478 TCAAATAATTTTAAAGCTAAAGG - Intergenic
1186869360 X:13754868-13754890 TCAAGGAAGTTAAGAGCTGTGGG + Intronic
1187637291 X:21243913-21243935 TCTAGAAATTTTATAGCTTGAGG + Intergenic
1187772784 X:22720371-22720393 TAAATAAATATTAGAGCTAGGGG + Intergenic
1187843651 X:23514387-23514409 CCACAGAATTTTAGTGCTAGAGG - Intergenic
1188508008 X:30904348-30904370 ACAAGTGATTTTAGAGATAGAGG - Intronic
1188825406 X:34826702-34826724 TCAAGGAATTTTATGGCTTCAGG - Intergenic
1191131794 X:57021590-57021612 TCAAGGAATTTTACAGTTTTAGG + Intergenic
1192418558 X:71007662-71007684 TCAATGAATGCTAGAACTAGTGG + Intergenic
1193219541 X:78907100-78907122 TATGGGAATTTTAGAGCTTGAGG + Intergenic
1193466984 X:81861331-81861353 TCTAGGATTTTTATAGCTGGAGG - Intergenic
1194398687 X:93417243-93417265 CCTAGGAGTTTGAGAGCTAGGGG + Intergenic
1196044197 X:111239610-111239632 TCCAGGATTTTTATAGTTAGAGG - Intergenic
1198277285 X:135107361-135107383 TCCAGGATTTTTAGAGTTTGAGG + Intergenic
1199936542 X:152579931-152579953 TCAAGGGATTTTATAGCTCAAGG - Intergenic
1200965862 Y:9037384-9037406 TCAAGGAAGTTAAGAACTATGGG + Intergenic
1201422760 Y:13818402-13818424 TGAAGGAACTTTATAGCTTGTGG - Intergenic