ID: 1094325352

View in Genome Browser
Species Human (GRCh38)
Location 12:29232023-29232045
Sequence GAACATATCTCAAAGGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094325347_1094325352 -6 Left 1094325347 12:29232006-29232028 CCTATGAAATTGAAAAAGAACAT 0: 1
1: 2
2: 5
3: 49
4: 744
Right 1094325352 12:29232023-29232045 GAACATATCTCAAAGGGGTTGGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094325352 Original CRISPR GAACATATCTCAAAGGGGTT GGG Intronic
902273181 1:15320079-15320101 GAAGAAATCACAAAGGGATTTGG - Intronic
908757709 1:67484344-67484366 GAACATAAGTCCAAGGAGTTGGG + Intergenic
908817945 1:68052724-68052746 GAACATGTGTCCAAGGTGTTTGG - Intergenic
918097360 1:181346212-181346234 GAAAAGATCTGAAAGGAGTTGGG - Intergenic
1064570084 10:16683719-16683741 GAACATATGTCCAAGGTGGTTGG + Intronic
1066295412 10:34049847-34049869 GAACTTCTCTCAAATGAGTTTGG - Intergenic
1068181617 10:53527116-53527138 GAACATGTGTCAAAGGTGGTTGG + Intergenic
1069679823 10:70276272-70276294 TAATGGATCTCAAAGGGGTTAGG - Intronic
1071460962 10:85895302-85895324 GAAGATATATCATGGGGGTTGGG - Intronic
1074940562 10:118232559-118232581 GGACATCTCTTAAAGAGGTTTGG + Intergenic
1075812129 10:125231908-125231930 GAAAATATCTGAAAGGGCTTCGG - Intergenic
1075864972 10:125710494-125710516 GAAGATTTCTAAAAGAGGTTAGG + Intergenic
1076034987 10:127192291-127192313 CAACATATTTCAAAGGGATTTGG - Intronic
1076590832 10:131580917-131580939 AAGCATATCTCAATGGGGATAGG + Intergenic
1076997062 11:303036-303058 CAAGACATCTCAAAGGGGTGTGG + Intergenic
1079353033 11:19709239-19709261 GAAAATATCTAAAAGGAGATAGG + Intronic
1080803204 11:35627964-35627986 GAAAATATGTGAGAGGGGTTGGG - Intergenic
1081530697 11:43957167-43957189 GAACATGTCTCCAAGGTGGTTGG + Intergenic
1081720961 11:45287948-45287970 GACCACATCACAAAGGGATTTGG - Intergenic
1081925645 11:46826247-46826269 CAACATATCCAAAAGGGGTACGG + Intronic
1083944452 11:65916268-65916290 CAACATCTCCCAAAGGGGTTGGG + Intergenic
1085243327 11:75076413-75076435 GATAATATCTCAAAGGGCTTGGG - Intergenic
1085400795 11:76234407-76234429 GGACATAGCTGAAAGGAGTTTGG + Intergenic
1086472627 11:87131734-87131756 GAACATACCTCATAGGGGAGGGG + Intronic
1094325352 12:29232023-29232045 GAACATATCTCAAAGGGGTTGGG + Intronic
1096600281 12:52724159-52724181 GAACAAATCCCAAAGAGATTAGG + Intergenic
1098508519 12:71283456-71283478 GAACACATGTCATGGGGGTTTGG + Intronic
1101610174 12:106283928-106283950 GAACAAATGACAAAGGGGTTTGG + Intronic
1106383875 13:29265771-29265793 GAACTTATCTCCAAGGAGATGGG + Intronic
1106812296 13:33370914-33370936 GAAAATATGTCAAAGTGGCTGGG - Intergenic
1107821471 13:44289468-44289490 GAACACTTATCAATGGGGTTAGG + Intergenic
1108228126 13:48311241-48311263 ATACATATCTCAAAGAGCTTTGG + Intronic
1108953913 13:56126206-56126228 GAAAATATCTCAAAGCAGCTGGG - Intergenic
1111348707 13:86997831-86997853 GAACATATCTCAAAAGAATAAGG + Intergenic
1113218305 13:108069093-108069115 AAACATATGTCCAAGGTGTTTGG - Intergenic
1116322094 14:43480844-43480866 GAACAGACCTCAAGGGGTTTTGG + Intergenic
1117947528 14:61044508-61044530 TAAAATATCTGAAGGGGGTTAGG - Intronic
1118477533 14:66132273-66132295 CAAGATATCTCACAGGGGATTGG + Intergenic
1118639895 14:67782627-67782649 GACCAGGTCTCAGAGGGGTTAGG - Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1120333099 14:83118616-83118638 GAACACATCTTAAATAGGTTTGG - Intergenic
1123226317 15:17036485-17036507 GAACATATCTTTGAGGAGTTTGG + Intergenic
1127679952 15:61284506-61284528 GCCCAGATCTCAAAGAGGTTAGG + Intergenic
1127695315 15:61441172-61441194 GAAAATTTCACAAAGGAGTTGGG - Intergenic
1128431562 15:67600402-67600424 CAACATAGCTCAAAAGGGTCAGG - Intronic
1128855276 15:71005999-71006021 GAAAATAACTGAAATGGGTTAGG + Intronic
1129415047 15:75371748-75371770 GAACTTTTCCCAAAGGGTTTTGG - Exonic
1131008387 15:88997246-88997268 GAACATATGTCCAAGGCGGTCGG - Intergenic
1137410118 16:48221206-48221228 TAACAGATCACAAAGGGGGTTGG + Intronic
1139662887 16:68433784-68433806 GAACATATATTCATGGGGTTTGG - Intronic
1141010290 16:80390625-80390647 GAAAATATCTCCCAGGGGTGGGG + Intergenic
1144646482 17:16977985-16978007 GAGCTGATCTCAAAGGTGTTGGG - Intergenic
1147398979 17:40167762-40167784 GAACATCTTTTAAAGGGCTTGGG + Intronic
1148497761 17:48064098-48064120 GTACATATCTCTAAGGGGGAGGG - Intergenic
1148917796 17:50997676-50997698 TAACCTATCTCAAAGGTGATTGG - Intronic
1150842624 17:68622980-68623002 GGAAATATCTCCAAGGGGATGGG + Intergenic
1155868815 18:30999864-30999886 GAACACTTCTAAAAGGGGCTTGG - Intronic
1156311165 18:35923369-35923391 GAACATGTCTCCAAGGTGGTCGG + Intergenic
1157704719 18:49795038-49795060 AAAGATATCTCAAATGTGTTTGG + Intronic
1160475461 18:79181432-79181454 GGTCATGTCTCAGAGGGGTTTGG - Intronic
1164353958 19:27393266-27393288 GCACACATCACAAAGGGGTTTGG + Intergenic
1167907131 19:52670677-52670699 GAACATATGTCCAAGGTGATGGG + Intronic
931064576 2:58571248-58571270 GAAAGTATCCAAAAGGGGTTAGG + Intergenic
931238229 2:60429800-60429822 GAACGTTTCTCATAGGGTTTTGG - Intergenic
931912370 2:66914621-66914643 CAACATATCTTTCAGGGGTTGGG + Intergenic
932155966 2:69417870-69417892 GATTATATCTTAAAGGGTTTTGG - Intronic
932744333 2:74319737-74319759 TTACAGATCTCAAAGAGGTTAGG - Intronic
933080078 2:77975201-77975223 GAACATGTATCGAAGGTGTTTGG - Intergenic
933270939 2:80232212-80232234 GAACATGTGGCAAAGTGGTTGGG - Intronic
934757426 2:96833763-96833785 GAACTTTTCTCAAAGGAATTTGG + Exonic
935487969 2:103681448-103681470 GAACACATCTGAAGGGGGTTGGG - Intergenic
936256333 2:110917394-110917416 GAACATATCTCAAAAGAATAAGG + Intronic
940849719 2:158676593-158676615 GAAAATATCTCAGAGGTGCTGGG - Intronic
942673677 2:178404217-178404239 GTACATATGGCAAAGGGGGTGGG - Intergenic
947166917 2:227271920-227271942 GATCTTACCTCAAAGAGGTTTGG + Intronic
1168769080 20:402792-402814 GAACATTTCTCAAATGTGATTGG + Intergenic
1173377409 20:42498963-42498985 GAACATGTCCCAAAGGCGGTTGG - Intronic
1176535751 21:8048159-8048181 GAACATATCTTTGAGGAGTTTGG - Intergenic
1178501672 21:33130831-33130853 GACCATTTCTCCAAGGAGTTTGG + Intergenic
1179460487 21:41531456-41531478 GAACATATGTCCAAGGTGGTTGG + Intergenic
1180400173 22:12410080-12410102 GAACATATCTTTGAGGAGTTTGG + Intergenic
1182540953 22:31041663-31041685 GAACTCATCACCAAGGGGTTGGG + Intergenic
949893998 3:8755851-8755873 GAGCATATTTCAAAGGGCTGAGG + Intronic
954574262 3:51666714-51666736 AAGCATAACTCAAAGGGGTGTGG - Exonic
956963381 3:74430334-74430356 GAAGATTTACCAAAGGGGTTGGG - Intronic
959769350 3:110073409-110073431 TCACTTATCTCAAAGGGGATGGG - Intergenic
960383710 3:116994360-116994382 TAATATATTTCAAAGGGATTTGG + Intronic
960464094 3:117974140-117974162 GAATCTATCTCATAGGAGTTTGG + Intergenic
960930397 3:122842692-122842714 AAACACAAGTCAAAGGGGTTGGG - Intronic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
965778869 3:172262239-172262261 TAACATTTCCCAGAGGGGTTGGG + Intronic
966052071 3:175631300-175631322 GAACAGATCTCACAGTGGTTTGG + Intronic
966101104 3:176269825-176269847 TAGCAGATCTCAAAGGGGCTTGG - Intergenic
966209675 3:177440216-177440238 GAAAATATCTGCAAGGGGATGGG - Intergenic
966633687 3:182108084-182108106 GAACATAGCTCAAAGGAGATAGG + Intergenic
971076416 4:23154136-23154158 GAACATATGTCCAAGGTGGTTGG - Intergenic
975421645 4:74171481-74171503 GCAAATATCTCAAAGGGGAATGG - Intronic
980040843 4:127938181-127938203 GCAAATATCTCAAAGGCTTTAGG + Intronic
982024148 4:151235092-151235114 TTACATGTTTCAAAGGGGTTTGG + Intronic
985797569 5:1974541-1974563 GAACATAATTCAAAGGGGCAAGG - Intergenic
986962789 5:13235831-13235853 GAACATATTTCAAAGAGGAGAGG - Intergenic
989729697 5:44633913-44633935 GCACATACCTCAAAGGAGCTAGG - Intergenic
990790716 5:59475592-59475614 GAAAATATCTTAAAGGGGCTGGG + Intronic
991065756 5:62422989-62423011 GAAAATATCAGAAAGGGGATTGG + Intronic
991179791 5:63736640-63736662 GAACATTTCTCTATGAGGTTTGG + Intergenic
995684318 5:114755677-114755699 GAGTATATTTCAAAGGGCTTTGG + Intergenic
996234619 5:121110196-121110218 GAAAATATTTCAGTGGGGTTGGG - Intergenic
1000523905 5:162331735-162331757 GAAGGTATCTCAAGGTGGTTTGG - Intergenic
1000552406 5:162683393-162683415 GTAGATATTTGAAAGGGGTTGGG + Intergenic
1001430236 5:171655115-171655137 GAACATTTCTCAAAAGAGTGAGG + Intergenic
1002872000 6:1175583-1175605 GCACTTAACTCAAAGGGGTGAGG - Intergenic
1004585756 6:16998356-16998378 GAAGATATCTCACAGGGTTTTGG - Intergenic
1005425972 6:25702688-25702710 GTACCTATCTCACAGGGATTTGG - Intergenic
1005835418 6:29705229-29705251 GAACTTGTCTCAAAAGTGTTGGG + Intergenic
1007861637 6:44915888-44915910 GAACATATGTCCAAGGTGGTTGG - Intronic
1011230125 6:85151165-85151187 GAACATGTGCCAAAGTGGTTGGG - Intergenic
1012769898 6:103419023-103419045 GAATATATCTCCAATGGCTTTGG - Intergenic
1015806399 6:137113444-137113466 AAACATGTATCAAAGGGGTGGGG - Intergenic
1017035017 6:150259281-150259303 GAACACATTGCAAGGGGGTTAGG + Intergenic
1017986555 6:159447811-159447833 GAATATCTGTCTAAGGGGTTTGG - Intergenic
1019213365 6:170423881-170423903 TAACACATCTCAAAGGGATGAGG - Intergenic
1021155811 7:17208292-17208314 GAACAGATCTCAAGGTGCTTGGG - Intergenic
1021332327 7:19354266-19354288 GAACATATCTCCTATGGGTAAGG + Intergenic
1022605857 7:31813283-31813305 AAACATATCTCAAAGCAGTCTGG - Intronic
1023103098 7:36738841-36738863 GAACATATCACAACTGGGGTGGG + Intergenic
1023411047 7:39889648-39889670 GATCATATTTTAAAAGGGTTTGG + Intergenic
1025830383 7:65044031-65044053 GAACATATACCATAGGGGATTGG + Intergenic
1025917544 7:65877815-65877837 GAACATATACCATAGGGGATTGG + Intronic
1030074136 7:105721852-105721874 CAAAATTTCTCAAAGGAGTTTGG - Intronic
1031636238 7:124104417-124104439 GAATATATCTGGAAGGGGTATGG + Intergenic
1034110042 7:148527951-148527973 GAACATATGCCCAAGGTGTTTGG - Intergenic
1035157855 7:156928806-156928828 GAACATATGTCCAAGGTGGTTGG + Intergenic
1035449610 7:158968026-158968048 CAAAATATGTCAAAGGGGCTAGG + Intergenic
1035933970 8:3816847-3816869 GAACATATTTCTCAGGGGTAAGG + Intronic
1037571713 8:20163567-20163589 GAGCATCCCTCAAAGGTGTTGGG - Intronic
1038352454 8:26789889-26789911 GAAGATATCTCATTGTGGTTTGG - Intronic
1039012236 8:33106451-33106473 GCACTTATCTCAAAGAAGTTAGG + Intergenic
1041536482 8:58931675-58931697 CCACATATCTCAAATGGTTTAGG + Intronic
1044732950 8:95246584-95246606 CAAAATCTCTCAATGGGGTTGGG + Exonic
1052560349 9:30077027-30077049 GAACATATGTCCAAGGTGGTCGG - Intergenic
1060780973 9:126412547-126412569 GAACACTTCTCAATGTGGTTGGG - Intronic
1185989625 X:4878723-4878745 AAATATATCTCTAAGGGTTTAGG - Intergenic
1186878360 X:13839390-13839412 GAACATATGTCTAAGGTGATTGG - Intronic
1189987849 X:46569955-46569977 GAAAATGTCTCAGTGGGGTTGGG + Intergenic
1190123309 X:47681914-47681936 CACCACATCTCAAAGGGGTAGGG - Intergenic
1192260877 X:69505266-69505288 GAACATATTTCAGGGGGGTCCGG - Exonic
1193657705 X:84218725-84218747 GATCATATCTGACAGGGGATGGG - Intergenic
1194202044 X:90964122-90964144 GAACACATGTCATGGGGGTTTGG - Intergenic
1198282209 X:135153492-135153514 GAACATACTTCACAGTGGTTAGG - Intergenic
1198284499 X:135176467-135176489 GAACATACCTCACAGTGGTTAGG - Intergenic
1198288750 X:135219030-135219052 GAACATACTTCACAGTGGTTAGG + Intergenic
1201462599 Y:14243305-14243327 GAACATATCTCAAAGTAATAAGG + Intergenic