ID: 1094329687

View in Genome Browser
Species Human (GRCh38)
Location 12:29277632-29277654
Sequence CCGGCAGATAATTTTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094329687_1094329691 5 Left 1094329687 12:29277632-29277654 CCTGCTTTAAAATTATCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1094329691 12:29277660-29277682 GACTCCAGAGATAGTGCCACTGG 0: 1
1: 4
2: 1
3: 12
4: 118
1094329687_1094329693 13 Left 1094329687 12:29277632-29277654 CCTGCTTTAAAATTATCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1094329693 12:29277668-29277690 AGATAGTGCCACTGGAGCTCAGG 0: 1
1: 0
2: 6
3: 25
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094329687 Original CRISPR CCGGCAGATAATTTTAAAGC AGG (reversed) Intronic
901156167 1:7140853-7140875 AAAGCAGATAATTTTACAGCTGG - Intronic
903062431 1:20679082-20679104 CCGGCAGATCATTTGAACTCAGG + Intronic
905605158 1:39291471-39291493 ATGGAAGATAATTTTAAAACAGG - Intronic
909270863 1:73621803-73621825 CCTTCAGAGAATTTTAAACCAGG + Intergenic
917150483 1:171938451-171938473 CAAGCACATAATTTTAAATCTGG + Intronic
918917816 1:190667876-190667898 CAGGAAGATAATTTTAATGAAGG - Intergenic
920382854 1:205545669-205545691 CCCTCAGATAATTCTGAAGCAGG - Intergenic
920577699 1:207073893-207073915 CCAGCAGATAACTTTAAGGTGGG - Exonic
920806889 1:209243186-209243208 CCCCCAGATAATTTGAAAGAAGG + Intergenic
922083595 1:222323774-222323796 ATGGCAAGTAATTTTAAAGCAGG + Intergenic
1063492941 10:6481916-6481938 ACTGCAGAAAATTTTCAAGCTGG - Intronic
1064869228 10:19919428-19919450 GCTGCAGATATTTTTACAGCAGG - Intronic
1065268830 10:24005564-24005586 CAGGAAAATAATTTTAAATCTGG + Intronic
1073536801 10:104284130-104284152 CGGGCAGATCATTTTAATCCAGG + Intronic
1075155240 10:119970765-119970787 CCATCAGATAATTTAAAAGATGG - Intergenic
1086051950 11:82602759-82602781 CAGGCAGATAATTTGAAGTCAGG + Intergenic
1088079966 11:105900314-105900336 CCAGGAGATTTTTTTAAAGCAGG - Intronic
1088495948 11:110430878-110430900 CCGGCAGATTACTTCAACGCAGG - Intronic
1093040683 12:14376247-14376269 CCAGCAGATGTTTTTAAAGGAGG - Intronic
1094329687 12:29277632-29277654 CCGGCAGATAATTTTAAAGCAGG - Intronic
1100172393 12:91990294-91990316 CCGGGTGATATTTTTAAAACAGG + Intronic
1100584527 12:95967446-95967468 CATGGAGAGAATTTTAAAGCAGG - Intronic
1109331692 13:60938922-60938944 CCACCAGTTAATTTTAAAGCAGG - Intergenic
1109996750 13:70137668-70137690 GCTCCAGATCATTTTAAAGCAGG + Intergenic
1110937976 13:81316999-81317021 CTGGCAGATAATTCTTAACCAGG + Intergenic
1112392202 13:98995786-98995808 CCGGAAGATACTTTTAAACATGG + Intronic
1112833462 13:103482552-103482574 CCTTCAGATAATTTCAAAGGAGG - Intergenic
1115353071 14:32417067-32417089 CGGGCAGATCATTTGAAAACAGG - Intronic
1117804393 14:59475751-59475773 TCAGAAGAGAATTTTAAAGCAGG - Intronic
1120651468 14:87138893-87138915 ACAGAAAATAATTTTAAAGCAGG - Intergenic
1121122133 14:91382791-91382813 AAAGCAGAGAATTTTAAAGCGGG - Intronic
1127379900 15:58421731-58421753 CAGGCAGATTATTTAATAGCTGG - Intronic
1127549596 15:60023836-60023858 CCGGCAGATCATTTGAAGTCAGG + Intronic
1135250513 16:20897778-20897800 CTGGCAGATAAATTTCAAGCTGG - Intronic
1136693795 16:32057751-32057773 CTGGCAGAGAATTCTAAACCAGG + Intergenic
1136794284 16:33000986-33001008 CTGGCAGAGAATTCTAAACCAGG + Intergenic
1136875623 16:33853393-33853415 CTGGCAGAGAATTCTAAATCAGG - Intergenic
1203096548 16_KI270728v1_random:1262667-1262689 CTGGCAGAGAATTCTAAACCAGG + Intergenic
1147494407 17:40902192-40902214 ACTGCAGATAATTGTAAACCTGG - Intergenic
1153667023 18:7375432-7375454 GGGGCAGATACTTTGAAAGCAGG - Intergenic
1161924764 19:7292671-7292693 CCAACAGATATTTTTAAAGCAGG + Intronic
1167058700 19:47130042-47130064 CAGGCAGATTACTTTAAATCAGG - Intronic
1167573073 19:50302352-50302374 CGGGCAGATCATTTGAAGGCAGG + Intronic
1168010131 19:53523444-53523466 CGGGCAGATAACTTGAAATCAGG - Intronic
927072459 2:19545131-19545153 CCCTCAGACTATTTTAAAGCAGG + Intergenic
930844144 2:55883346-55883368 ACAGCAGATAATTTCAAAGCAGG - Intronic
931895305 2:66722197-66722219 GCGGAAGAAAATTTCAAAGCTGG + Intergenic
935841240 2:107113451-107113473 CCTGCAGATAAATTTCAATCTGG - Intergenic
937015823 2:118604460-118604482 CCTCCAGATTATTTTAAAACAGG - Intergenic
944579689 2:201121174-201121196 CTGGCAAATAATTATAAAGCTGG + Intronic
1169254265 20:4085324-4085346 CTGGCTGAGATTTTTAAAGCAGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1177591681 21:23178635-23178657 CCAGTAAATAATTTAAAAGCAGG - Intergenic
1178785661 21:35650887-35650909 CCTGCAGGTGATTTTAAAGCAGG - Intronic
1184032982 22:41905609-41905631 CCAGCAGATGATTGTTAAGCTGG + Exonic
959097993 3:101976725-101976747 CAGACACCTAATTTTAAAGCTGG - Intergenic
959432741 3:106274963-106274985 CCAGCAGATGATTTTAAGCCTGG - Intergenic
964753414 3:160073244-160073266 CAGGCAGATAATTTGAAGTCAGG - Intergenic
965451323 3:168841935-168841957 CTGGCTGATAATTTTACATCTGG + Intergenic
970535864 4:17029238-17029260 CTGGCAGAGAATTTTCAAACTGG - Intergenic
973868420 4:55138890-55138912 CCGGCCAAGAATTTTAAAGGTGG - Intergenic
978203261 4:106048139-106048161 CCTGTAGATGATTCTAAAGCAGG + Intronic
979707667 4:123739649-123739671 CCGACACATAAATTCAAAGCAGG - Intergenic
979767796 4:124483078-124483100 CCTGCATAGAATTTTAAAGGAGG - Intergenic
984079036 4:175219804-175219826 CTTGCATATAATTTTAAATCGGG + Intergenic
986506187 5:8454553-8454575 GCTGCAGAAAAGTTTAAAGCTGG + Intergenic
987765370 5:22221357-22221379 CCCTTAGATAATTTTGAAGCAGG + Intronic
991332150 5:65503400-65503422 CCGGCCTATAATTTTAAATTAGG + Intergenic
992216218 5:74527365-74527387 CCCAAAGATAATTTTAAAGCAGG - Intergenic
992626816 5:78643700-78643722 CTGGCATGTAAATTTAAAGCAGG - Intronic
997074863 5:130661760-130661782 TCTACAGATAATTTTAAAGGTGG + Intergenic
999460829 5:151756699-151756721 CGGGCAGATCACTTTAATGCAGG - Intronic
1006391347 6:33760827-33760849 CCTGCAGATGTTTTTAGAGCTGG + Intergenic
1012319103 6:97820396-97820418 CCTGCAACTAATTTTTAAGCAGG + Intergenic
1018973948 6:168549757-168549779 CCGGCATATATTTTTAAATTCGG + Intronic
1021686963 7:23195263-23195285 CTGGCAGAAATTTTAAAAGCTGG - Intronic
1023821904 7:43985335-43985357 CAGGCAGATAATGTTTGAGCGGG - Intergenic
1029750169 7:102538757-102538779 CAGGCAGATAATGTTTGAGCGGG - Intronic
1029768120 7:102637865-102637887 CAGGCAGATAATGTTTGAGCGGG - Intronic
1032201877 7:129827896-129827918 CCAGCACATAATTTTCAAGTTGG + Intergenic
1032965150 7:137088155-137088177 CCGGCAGATCACTTGAAATCAGG + Intergenic
1033883633 7:145917484-145917506 TGGGCAGATAACTTTAAATCAGG + Intergenic
1037696253 8:21226794-21226816 CTGGTAGATTTTTTTAAAGCTGG + Intergenic
1039114275 8:34074962-34074984 CCCTCAGATGATTTTAATGCAGG - Intergenic
1042866472 8:73361054-73361076 CTGACAGAGAACTTTAAAGCAGG - Intergenic
1044105745 8:88204127-88204149 TCGGCAGATTATTTTACAGATGG - Intronic
1046297926 8:112246185-112246207 CCAGCAGCTTACTTTAAAGCAGG - Intronic
1047244706 8:123130916-123130938 CCGGCAGTTAATTTTTAATTAGG + Intronic
1051568436 9:18527167-18527189 ATGGCAAAGAATTTTAAAGCAGG - Intronic
1055208561 9:73762482-73762504 CTGGCTGCTATTTTTAAAGCAGG + Intergenic
1055327753 9:75149489-75149511 TTTGCAGATAATTTTAAAGATGG + Intergenic
1058473223 9:105302840-105302862 CTGGCAGCTAATGTTAAAGATGG + Intronic
1058905056 9:109476079-109476101 CAGGCAGAGGATTTTAAAGCTGG - Intronic
1060797176 9:126520611-126520633 TCGGCAGATAATTTTAAAAGAGG - Intergenic
1199253699 X:145694342-145694364 GAGGGAAATAATTTTAAAGCTGG + Intergenic