ID: 1094330232

View in Genome Browser
Species Human (GRCh38)
Location 12:29284040-29284062
Sequence AAACAGATAGACGTGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094330232 Original CRISPR AAACAGATAGACGTGGGACA TGG (reversed) Intronic
902399522 1:16150430-16150452 CAACAGCTAGAGGTGGGAAAGGG + Intronic
904463071 1:30692037-30692059 AAACAGAAAGAAGTGCGTCAGGG + Intergenic
905150590 1:35923804-35923826 AAACAGAATGAGGTGGGAAAGGG + Exonic
906360044 1:45147904-45147926 AAACAGAGAGATGTGGGGGAGGG + Intronic
907150182 1:52278553-52278575 AAACAAATACAAGTGGGTCAGGG - Exonic
907174736 1:52508440-52508462 AAGCAGATAGAACAGGGACAAGG - Intronic
907801936 1:57776735-57776757 CAACAGATAGAAGGGGGAAATGG - Intronic
908689699 1:66764447-66764469 AAAGAGAGAGACATGGGAAATGG + Intronic
908747925 1:67393854-67393876 CAAAAAATAGCCGTGGGACAAGG - Intronic
909079439 1:71091199-71091221 AAAGAGAAAGAAGTGGGACGAGG + Intergenic
913185408 1:116366157-116366179 AAGGAGATTGACGTGGGAAAAGG + Intergenic
915141655 1:153771952-153771974 CAAGAGACAGAGGTGGGACACGG + Exonic
915450109 1:155998937-155998959 AAACAGATGGAAGGGGGACTAGG - Intronic
922767226 1:228162480-228162502 AAACGGATGGAGGTGAGACATGG - Intergenic
1065051811 10:21800181-21800203 AAACACAGAGACTTGGTACAAGG - Intronic
1065928433 10:30457129-30457151 AAACAAAGAGAGGTGGGGCATGG - Intronic
1067175329 10:43941941-43941963 AAAAATACAGACGTGGGACTAGG + Intergenic
1069379924 10:67832563-67832585 AAACAAATAAATGTGGGAGAAGG + Intronic
1069939881 10:71948123-71948145 GAACAGGTAGAGGTGGGACAAGG - Intergenic
1070644732 10:78193971-78193993 AAACACATAGAGGGGAGACAAGG - Intergenic
1071923792 10:90381758-90381780 AAACAGACAGCAGTGGGAAATGG + Intergenic
1073186807 10:101619925-101619947 ACACACATAGACGTGGGTGATGG + Intronic
1073391963 10:103186233-103186255 AAACAGGTAGAGTTGGAACAAGG + Intronic
1073915271 10:108396240-108396262 TAACAGATAGAGGTGTGACACGG + Intergenic
1075275259 10:121087005-121087027 AAACAGATACAAGTGGATCAGGG - Intergenic
1077257797 11:1596602-1596624 AAACAGATGGACTTGGCTCAGGG + Intergenic
1078054251 11:7994381-7994403 AAACAGATGGCCTTGGGAGAGGG - Intronic
1083373490 11:62201081-62201103 AAAGAGAAAGACATGGGACTCGG + Intergenic
1084507154 11:69575396-69575418 AGAGAGAGAGACGTGGGACACGG - Intergenic
1084804182 11:71567289-71567311 AAACAGATGGACTTGGCTCAGGG - Intronic
1084806252 11:71581281-71581303 AAACAGATGGACTTGGCTCAGGG + Intronic
1085624734 11:78063416-78063438 AAACAGCTTGATGTGGGGCAAGG - Intronic
1085678318 11:78546413-78546435 CAACAGAAAGATGTGGGACTGGG + Intronic
1085758659 11:79223075-79223097 ACACAGGTAGACGTGTGCCATGG - Intronic
1086851325 11:91812645-91812667 GAACAGAAATATGTGGGACACGG - Intergenic
1087520628 11:99230710-99230732 ACACAGATAAACGTGTGCCATGG + Intronic
1087748193 11:101973601-101973623 ACACAGATAGATGTGTGCCATGG - Intronic
1088028760 11:105219989-105220011 AGAGAGAGAGAAGTGGGACATGG + Intergenic
1089683473 11:120132432-120132454 AAACAGACAGGTGTGGGAGAAGG - Intronic
1093959106 12:25252755-25252777 AAAGAGACAGATCTGGGACAAGG - Intergenic
1094330232 12:29284040-29284062 AAACAGATAGACGTGGGACATGG - Intronic
1096108824 12:49016633-49016655 GAACAGATAGATTTGGGCCAAGG - Intronic
1096929368 12:55188650-55188672 AAACAGGTAAACGTGTGCCATGG - Intergenic
1097932436 12:65204226-65204248 ACACAGATAAACGTGTGCCATGG + Intronic
1101014908 12:100490346-100490368 AAAAAGACAGATGTGAGACAAGG + Intronic
1104496803 12:129248604-129248626 ACACAGGTAGACTTGGGTCATGG + Intronic
1105581487 13:21701073-21701095 AAATAGATAAACGTGTGCCAAGG + Intronic
1106359537 13:29018035-29018057 AAACAGGTAGAGGTGGAACTAGG - Intronic
1108248791 13:48544334-48544356 AAACAAATAGACGTGGTTGAAGG + Intergenic
1110571543 13:77010266-77010288 AAACACACAGACATGGGAAATGG + Intronic
1110708830 13:78627277-78627299 AAACAGGTAGAGGTGGGATGGGG - Intronic
1111796243 13:92924112-92924134 ACACAGATAAACGTGTGCCATGG + Intergenic
1113977867 13:114244349-114244371 AAACTGATACATGTGGGAGATGG - Intronic
1116047406 14:39761686-39761708 AATGAGATAGACGCCGGACACGG + Intergenic
1119046504 14:71321879-71321901 GAACAGAGAGACATGGGAAATGG + Intronic
1120283733 14:82471109-82471131 ATACAGAAAAAAGTGGGACAGGG - Intergenic
1120319213 14:82937261-82937283 ACACAGATAAACGTGTGCCATGG - Intergenic
1122670133 14:103365447-103365469 AGACAGACAGACGTGGGTAAAGG - Intergenic
1123744672 15:23310418-23310440 AAAGAGAGAGCCCTGGGACATGG - Intergenic
1125017494 15:34950546-34950568 AAATGGATAGACGTGGGGGAGGG - Intronic
1125613047 15:40985524-40985546 AAACAGATAGAAGTGATACTTGG - Intronic
1127357481 15:58214413-58214435 CAACAGCTAGATGGGGGACAGGG + Intronic
1128522847 15:68386902-68386924 AAGCAGGGAGAGGTGGGACAGGG + Intronic
1131955386 15:97729789-97729811 AAACAGATAGATGAGGGAGGAGG - Intergenic
1133563791 16:6973830-6973852 AAACAGGTAAACGTGTGCCATGG + Intronic
1133852722 16:9521194-9521216 AAACAAAGAGACATGAGACAAGG - Intergenic
1134319474 16:13149627-13149649 AAAGAGATAGTCATGGGACCAGG + Intronic
1140138616 16:72231532-72231554 AAACAAATAGAGATGAGACATGG + Intergenic
1141021356 16:80499838-80499860 AAACAGACAGACCTGTGAAAAGG + Intergenic
1141292948 16:82737286-82737308 AAAGAGAGAGACATGGGAGAGGG - Intronic
1141315898 16:82962216-82962238 AAACAGATACACAGGGGAGAGGG + Intronic
1141769716 16:86082457-86082479 AAAGAGAGAGAAGTGGGGCATGG + Intergenic
1142182453 16:88677915-88677937 ATGCACATAGACGTGTGACATGG + Exonic
1143866744 17:9929101-9929123 AAACCTATATACGTGGGAAAGGG - Intronic
1147451773 17:40510182-40510204 AAACAGATAGGCGGGGGGCTGGG + Intergenic
1148766284 17:50040414-50040436 ACACACATAGACATGAGACATGG + Intergenic
1155193935 18:23455361-23455383 AAAAAGAAAGACGTTGGGCATGG - Intronic
1158498896 18:57982595-57982617 TGACATATAGACGTGGGGCAGGG + Intergenic
1162123554 19:8486856-8486878 TAATAGATACATGTGGGACAAGG - Intronic
1162832152 19:13292042-13292064 AAGCAGATAGGCCTGGGAGAAGG + Intronic
1166186933 19:41146061-41146083 AAACATATAGATGTTGGCCATGG - Intergenic
1166873401 19:45883914-45883936 ACACAGATAGAGGTGGCACTGGG + Exonic
926940170 2:18127246-18127268 AAACAGAAATACATGGGCCAAGG + Intronic
926943437 2:18162408-18162430 GAACACATGGACATGGGACAGGG - Intronic
927258235 2:21059594-21059616 AAACACTTAGATGTAGGACAGGG + Intergenic
930125888 2:47796052-47796074 GAAGAGATGGAGGTGGGACACGG + Exonic
931184458 2:59936667-59936689 AAACAGCTAGTCCTGGTACAAGG + Intergenic
931218081 2:60264636-60264658 AAAGAGATAAAGGTGGGACGAGG - Intergenic
932297332 2:70637577-70637599 AAAGAGAAGGACATGGGACATGG + Intronic
933593744 2:84261471-84261493 AAAAAAAAAGAAGTGGGACAGGG + Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937112488 2:119377331-119377353 AATTAAATAGACATGGGACAAGG + Intergenic
938275030 2:130011848-130011870 AAACAGATATACATGGGACATGG + Intergenic
938325990 2:130402573-130402595 AAACAGATATACATGGGACATGG + Intergenic
938363953 2:130718893-130718915 AAACAGATATACATGGGACATGG - Intergenic
938440344 2:131325436-131325458 AAATAGATATACATGGGACATGG - Intronic
941585989 2:167360004-167360026 AAGCAGATATACATGGTACATGG - Intergenic
944192461 2:197018147-197018169 TAACAGATTGCAGTGGGACAAGG - Intronic
948253285 2:236548074-236548096 AAAAACATAGACATGGGAAATGG - Intergenic
1170560859 20:17557230-17557252 AGAGAGATTGACGTGGGACCTGG - Intronic
1173262783 20:41451484-41451506 GCACAGACAGAGGTGGGACAGGG + Intronic
1174066741 20:47871368-47871390 AAACAGATAAACCTTGGTCAGGG - Intergenic
1174241205 20:49136614-49136636 AGACAGATATATGTGGGACGTGG + Intronic
1174785054 20:53424618-53424640 AAATAGATAAACGTGTGCCATGG + Intronic
1177858395 21:26424975-26424997 GAACAGACTGACGTGGGGCAAGG + Intergenic
1181762430 22:25067494-25067516 AAAGAGAAAGACGAGAGACATGG - Intronic
1181986217 22:26801493-26801515 AACCACATAGTCCTGGGACATGG - Intergenic
1184369960 22:44075989-44076011 AAACTGATGGCCGTGGGGCAGGG + Intronic
1185125294 22:49007149-49007171 AAGCAGACAGCCGTGGGGCAGGG + Intergenic
952920300 3:38279315-38279337 AACCAGATAGAAGTGGGGAAAGG + Intergenic
953057391 3:39399019-39399041 AAACAGATACACAAGGGAAAAGG - Intergenic
953376126 3:42430034-42430056 CAACATATAAACGTGGGAGAGGG - Intergenic
955559411 3:60172600-60172622 AGAAAGAAAGACGTGGGATAGGG + Intronic
960628011 3:119700535-119700557 ACACAGACAGACCTAGGACATGG + Intergenic
962366768 3:134791968-134791990 ATACAGATATACCTGGGACTGGG + Intronic
964541917 3:157789088-157789110 AAACAGATAAAAGTAGGAAAGGG - Intergenic
966621203 3:181966121-181966143 AAACAGTAAGAGGTGGGGCAGGG + Intergenic
968769272 4:2493438-2493460 ACACAGGTAGCTGTGGGACATGG + Intronic
969474511 4:7413843-7413865 GAACATAGAGACGTGGGGCAGGG - Intronic
970566728 4:17338921-17338943 TAACAGATAAACGTGTGTCATGG + Intergenic
971159804 4:24122039-24122061 AAACAGAAATACATGAGACAGGG + Intergenic
973623874 4:52751879-52751901 AACCAGATCGACGAGGGCCAAGG - Intergenic
974778699 4:66522811-66522833 AAAAAGATAGAACTGGAACATGG - Intergenic
977733080 4:100379100-100379122 AAAAAGAGAGACATGGGATAGGG + Intergenic
980585823 4:134815443-134815465 ACACAGATAAACGTGTGTCATGG + Intergenic
981215017 4:142154216-142154238 AAAAAGAAAAACCTGGGACAAGG + Intronic
982359930 4:154508672-154508694 GAACTGATATACGTGGAACATGG - Intergenic
983425074 4:167573556-167573578 AAAAAGATAAAAGTGGCACAAGG + Intergenic
985354393 4:189102246-189102268 CTACACATGGACGTGGGACACGG + Intergenic
986594860 5:9410766-9410788 GCACAGATATACGTGGGCCATGG - Intronic
988929120 5:36018665-36018687 AGACAGATAGATGAGGGATAAGG - Intergenic
989489497 5:42033438-42033460 ACACAGATATACGTGTGTCATGG + Intergenic
991038542 5:62152620-62152642 AAACAGATCCAAGTGGTACATGG + Intergenic
992092324 5:73328288-73328310 GAACACAAAGACTTGGGACATGG + Intergenic
994063905 5:95512979-95513001 AAAAAGATAGACATGAGATAAGG - Intronic
995555893 5:113328386-113328408 TAAAAGATACAAGTGGGACAGGG + Intronic
1002988064 6:2210658-2210680 AGACAGACAGAGGTGGGCCATGG + Intronic
1004337641 6:14778788-14778810 AAACAGATAGAAAAGGGAGATGG + Intergenic
1005839867 6:29736728-29736750 ACACAGCAAGACCTGGGACATGG - Intronic
1006963136 6:37954531-37954553 AAAAAGCTAGACGGGAGACAAGG - Intronic
1007378443 6:41471615-41471637 AGACAGATAGGGGTGGGACTGGG + Intergenic
1007393875 6:41566165-41566187 CAAGAGATAGAAGTGGGACTCGG + Intronic
1007636988 6:43305618-43305640 AACCAGATAGAAATGGGAAAGGG + Exonic
1008126871 6:47678735-47678757 AAATAGATAAAAGTGGAACACGG - Intronic
1008750007 6:54721365-54721387 AAACATATACACATGAGACATGG - Intergenic
1010915283 6:81609409-81609431 AAACAGATAGATAGAGGACAGGG - Intronic
1014645549 6:123968242-123968264 AAAGAGAAAGAGGTGGGCCAGGG + Intronic
1015281971 6:131443535-131443557 AAACACATAGTCTTGGGACCTGG + Intergenic
1019838742 7:3417279-3417301 GAACAAATAGAGGTGGGACATGG + Intronic
1020533160 7:9360180-9360202 ACACAGATATACGTGTGCCATGG + Intergenic
1022635208 7:32125776-32125798 ACATAGATATACGTGTGACATGG - Intronic
1022965910 7:35471431-35471453 AAATAGGTAGACGTGTGCCATGG + Intergenic
1024693063 7:51824029-51824051 AAACAGAGAGTCTAGGGACAGGG - Intergenic
1026819889 7:73540009-73540031 AAGCTGATAGACGTCAGACACGG + Exonic
1028220798 7:88194539-88194561 CACCACATAGACGTGGGCCAAGG + Intronic
1029895670 7:103981188-103981210 AAACATCTAGACGTGTGACATGG - Intronic
1030674488 7:112370361-112370383 ACACAGATAGCCCTGGGGCAAGG - Intergenic
1032283586 7:130525085-130525107 AAAAAGAGAGACGTGGGAGTGGG + Intronic
1032748258 7:134809889-134809911 ATACAGACAGAAATGGGACATGG + Intronic
1032958202 7:136998700-136998722 AAACAGATCAACGTGAGAAACGG + Intronic
1033528950 7:142244226-142244248 AAACAGAGAGAAGAGGGAAATGG - Intergenic
1033989381 7:147265250-147265272 ACACAGATAAACGTGTGCCATGG + Intronic
1037314365 8:17587051-17587073 AAACAGTTAGACATGGGATTTGG + Intronic
1038536590 8:28357813-28357835 AAACACAGAGAGGTGGGATAGGG + Intronic
1040468733 8:47718826-47718848 AAATAGGTAGACGTGTGCCATGG + Intronic
1041594065 8:59625278-59625300 AAAAAGATAAAATTGGGACAGGG - Intergenic
1042235168 8:66604774-66604796 CAACTGATAGATGAGGGACATGG + Intronic
1045712405 8:105000221-105000243 ACACAGGTATACGTGTGACATGG - Intronic
1046499067 8:115052417-115052439 AAACAGGTAAACGTGTGTCATGG - Intergenic
1047145749 8:122197410-122197432 AAACATATACAGCTGGGACATGG + Intergenic
1048370204 8:133770530-133770552 AAACAGATATACATGGTGCATGG - Intergenic
1048832432 8:138489821-138489843 ACATAGATAAACGTGGGATAAGG - Intronic
1050080274 9:1908595-1908617 ACACAGGTAAACGTGGGCCATGG - Intergenic
1053245632 9:36532507-36532529 AAACACCTAGAGGTGGCACAGGG - Intergenic
1057979743 9:99648894-99648916 AAACAAATAGATGTGGCATATGG + Intergenic
1059777598 9:117491483-117491505 AAACAGAGAGACTTAGGACCTGG + Intergenic
1061577946 9:131519345-131519367 TAACAGATAGAAGTAGCACAAGG - Intronic
1186494581 X:10002077-10002099 AGACAGAGAGAGGCGGGACACGG + Intergenic
1187736362 X:22308151-22308173 AAGCAGACTGACTTGGGACAGGG + Intergenic
1187897848 X:23999243-23999265 AAAAAGGAAGACGTGGAACAGGG - Intronic
1189872799 X:45402165-45402187 ACACAGGTAGACGTGTGCCACGG + Intergenic
1191185194 X:57604188-57604210 ACACAGATAAACGTGTGCCATGG + Intergenic
1191735966 X:64388032-64388054 AAACAGATAAACGTGGATTATGG - Intronic
1196649152 X:118151135-118151157 AAACAGAAATAAGTGGGGCATGG - Intergenic
1198543030 X:137660816-137660838 AAACAAATACAAGTGGGTCAGGG - Intergenic
1198666157 X:139025536-139025558 GAACAGAAAGATGTGGGGCAGGG - Intronic
1199836919 X:151600255-151600277 AAAGAGAGAGACGAGGGAGAGGG + Intronic