ID: 1094330968

View in Genome Browser
Species Human (GRCh38)
Location 12:29292868-29292890
Sequence ATAAGGTTGATAAAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094330965_1094330968 4 Left 1094330965 12:29292841-29292863 CCTCAATGCTTTTGACATCTGGG 0: 1
1: 0
2: 2
3: 26
4: 228
Right 1094330968 12:29292868-29292890 ATAAGGTTGATAAAGTGTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094330968 Original CRISPR ATAAGGTTGATAAAGTGTCC TGG Intronic
901288786 1:8105191-8105213 AAAAGGTAGATCAAGTGGCCTGG - Intergenic
903906347 1:26690082-26690104 ATAGGCTTGATGAAGTGTGCTGG + Intergenic
907932344 1:59012297-59012319 ATAAGGTTGAAAAAGTATGAAGG - Intergenic
909759796 1:79272328-79272350 ATAAGGTTGCTGAAGTTTGCTGG - Intergenic
911231005 1:95361739-95361761 ATTAGGTTGATTGAGTGTCTAGG + Intergenic
911749333 1:101478712-101478734 ATAATGTTGATCAAATGTCTGGG + Intergenic
917118895 1:171628608-171628630 ATGAGGTTGCTACATTGTCCAGG - Intergenic
917532193 1:175845384-175845406 AGAAGGTTGAGAAGGTGTCAAGG + Intergenic
918076937 1:181177566-181177588 AGAAGGTTGATAAAGGGGCCTGG + Intergenic
921657515 1:217758430-217758452 ATAAGGTTGATAAAGATTAAAGG - Intronic
1064379398 10:14827499-14827521 ATAAGTTTGATTAATTGTCTTGG + Intronic
1066471211 10:35700096-35700118 TTTAGGTTGATAAATTTTCCAGG + Intergenic
1067999880 10:51320205-51320227 GTAAGGTAGATGAAGTTTCCAGG - Intronic
1071243877 10:83741239-83741261 ATAATGGTGAAAATGTGTCCAGG - Intergenic
1072333579 10:94377294-94377316 TCAAGGTTGAGAAAGTGTCTGGG + Intergenic
1080419479 11:32097278-32097300 ACAAGGATGATAAAATTTCCTGG + Exonic
1081186826 11:40053220-40053242 ATAAGGTGGGTTAGGTGTCCAGG - Intergenic
1089320970 11:117626493-117626515 ATCAGGTAGTTAAAGAGTCCAGG + Intronic
1089852418 11:121511467-121511489 ATTAAGTTGATAAAATGTCATGG - Intronic
1092452002 12:8611060-8611082 ATAAGGAAGAAAAAGTGTCCTGG + Intronic
1094330968 12:29292868-29292890 ATAAGGTTGATAAAGTGTCCTGG + Intronic
1100837953 12:98585037-98585059 CTAAGGCTGATGAAGTGTCCTGG - Intergenic
1102753009 12:115312422-115312444 ATAAGTTTGGTAAAGCTTCCAGG - Intergenic
1106920119 13:34554074-34554096 ATAAGGTAGAAAAAGGGTCTAGG - Intergenic
1108713151 13:53053934-53053956 ATTAAGTTTATAAAGTGTCTAGG + Intergenic
1109556213 13:63979104-63979126 ATAAGGTAAATAAAATATCCTGG + Intergenic
1110902722 13:80843768-80843790 ATAACTTTGATAAAATGACCAGG + Intergenic
1113216864 13:108051752-108051774 ATAAGGTTTCTAATGTGACCAGG + Intergenic
1114540942 14:23457816-23457838 ATGAGGTTGAGAAGGTTTCCAGG + Intergenic
1116189647 14:41647651-41647673 ATCAGGAGGATAAAGTGTTCAGG + Intronic
1120239216 14:81930283-81930305 ATTAAGTTGATAAAGTCTACAGG - Intergenic
1120278267 14:82406395-82406417 CTGAGGTTGGTTAAGTGTCCTGG + Intergenic
1121672428 14:95722995-95723017 ATCTGGTTGGTAAAGAGTCCGGG + Intergenic
1122054798 14:99087846-99087868 ATATGCATGATAATGTGTCCAGG + Intergenic
1124590940 15:31052273-31052295 ATATGGATGAAAAAGTGTCTTGG + Intronic
1124696588 15:31869446-31869468 ATGAGGCAGATAATGTGTCCAGG - Intronic
1130388984 15:83438302-83438324 ATCAGGTAGATAAAGTGCCATGG + Intergenic
1135794307 16:25426533-25426555 ATAAGGTTAATAAACAGTCTTGG - Intergenic
1136668207 16:31832765-31832787 AGAAGGCTGAGGAAGTGTCCAGG - Intergenic
1138859083 16:60733413-60733435 GTAAGGTTGATAAAGGAGCCAGG + Intergenic
1139055416 16:63177488-63177510 AAAAAGTTGATAATGTGGCCGGG - Intergenic
1141595390 16:85094087-85094109 TTAAGGTTGAGAAAGTTTCAAGG + Exonic
1148707222 17:49646115-49646137 ATAAAGATGATAAAATGTACAGG - Intronic
1148773306 17:50079220-50079242 AGAGGGTTGATAAGGTCTCCAGG - Exonic
1149812056 17:59685222-59685244 ACAAGGTTGATAAAGTTGCGGGG + Exonic
1150420508 17:65030128-65030150 ATAAAAGTGATAAAGTATCCTGG + Intronic
1151220319 17:72606691-72606713 ACAAGGTGGAGAAAGTGGCCAGG - Intergenic
1156519528 18:37710244-37710266 ATAAGAATTATAAAGTGTCCAGG - Intergenic
1157174138 18:45435717-45435739 AACAGGTTGATATAGAGTCCTGG - Intronic
1157730151 18:49996904-49996926 ATAAGATTGGTAAGGTGTACTGG + Intronic
1159416852 18:68162404-68162426 ATATGGCTAATAAATTGTCCTGG - Intergenic
1159867657 18:73725239-73725261 ATATGGTTGGTATAGTGTCTGGG - Intergenic
1160558187 18:79739710-79739732 ATCAGGAGAATAAAGTGTCCTGG + Intronic
1165043077 19:33082546-33082568 AAAAGGTTGAGAAAGGGGCCAGG + Intronic
1166965486 19:46527273-46527295 CTAAGGTTGATGAAGTGTGCCGG - Intronic
928064347 2:28148307-28148329 ATAAGCTTAATAAACAGTCCTGG - Intronic
928497586 2:31849832-31849854 ATTAAGTTGTTAAAGTGTTCAGG + Intergenic
929067408 2:37992835-37992857 ATAAGGTTAATAATTTGCCCAGG + Intronic
931027787 2:58133527-58133549 ATAAGGGAGATACAGTGTCTTGG - Intronic
938948699 2:136237719-136237741 GTAATATTGAAAAAGTGTCCAGG + Intergenic
939094195 2:137814441-137814463 ATAATGTAAATAAAGTGTCTGGG + Intergenic
939638593 2:144612271-144612293 ATGGAGTTGGTAAAGTGTCCTGG + Intergenic
940214590 2:151291292-151291314 AAAAGGTTTATAAAATGTCCAGG - Intergenic
940281472 2:151993874-151993896 TTAAAGTTGAAAAAGTGGCCAGG + Intronic
940906066 2:159171071-159171093 GTGAGGCTGATCAAGTGTCCTGG + Intronic
943291849 2:186083115-186083137 AGAAGTTTGATTAAGTGTGCTGG - Intergenic
944946587 2:204694091-204694113 GGAAGGTTGAAAAAGTGTGCAGG + Intronic
947503617 2:230690379-230690401 ATAAGGTACATAAAGTGTGTTGG - Intergenic
1169231826 20:3894737-3894759 TTAAAGTTGATAAACTGGCCAGG - Intronic
949837478 3:8284981-8285003 ATAAGGTTGATGACCTTTCCAGG + Intergenic
954602592 3:51881200-51881222 ATAAGGAGGATAAAGTGACCAGG + Intergenic
954794343 3:53154006-53154028 AGAAGGTTGATAGTGGGTCCAGG + Intergenic
956036507 3:65098408-65098430 ATAAGGTTGATGAAAAGTCTAGG + Intergenic
957591167 3:82200255-82200277 ATAAGGTTGGCAAATTATCCTGG + Intergenic
971169844 4:24222230-24222252 AGAAGGTTGATGAAGAGTCCTGG - Intergenic
971315778 4:25566801-25566823 ATAATGTTGATAAAATGAACTGG - Intergenic
971718137 4:30208164-30208186 AAAAGGTTAATATAGTGTTCAGG - Intergenic
972008186 4:34138763-34138785 ATAAGGTGGGCAAAGTGGCCAGG + Intergenic
975971718 4:80047448-80047470 GTAAGGGTGCAAAAGTGTCCAGG - Intronic
976467544 4:85387920-85387942 AAAAGGATGACAAAATGTCCAGG + Intergenic
978024292 4:103852425-103852447 ATAAGGTTGACAACGTGAACTGG + Intergenic
979185084 4:117778917-117778939 ATAATTTTGATAAAGTATACTGG - Intergenic
979974142 4:127174979-127175001 ATAAACTTGATATATTGTCCTGG - Intergenic
981815192 4:148823137-148823159 ATAAGTTTGATTAAGTTTTCTGG - Intergenic
983459708 4:168013210-168013232 ATAAGATTGATCAAGTTGCCTGG - Intergenic
986166857 5:5280513-5280535 ACAAGGTTGGGAAAGTGTCTTGG + Intronic
987857573 5:23440751-23440773 ATAAGGTTGTTATAGTGGCAAGG - Intergenic
990642066 5:57797750-57797772 ATAAGGTAAATAAAGAGTTCTGG - Intergenic
993349414 5:86829632-86829654 ATCAAGTTGATAAACTTTCCAGG - Intergenic
993768839 5:91898783-91898805 ATAAGGTCTATAAAGTGCACTGG + Intergenic
994524367 5:100884032-100884054 ATAAGGTAGATAAAGAATCTAGG + Intronic
996173079 5:120320392-120320414 ATAAGAGTGATAAAGCATCCTGG - Intergenic
998693614 5:144614289-144614311 ATAATTTAGCTAAAGTGTCCTGG + Intergenic
999947797 5:156616288-156616310 ATCAGGATGATATAGTGTGCTGG + Intronic
1001816459 5:174673248-174673270 ATAAGAATGATAAAATGTCCTGG - Intergenic
1007351146 6:41274414-41274436 ATGAAGTTGACAAAGTGACCAGG - Intronic
1010071043 6:71745884-71745906 ATAAGCTTGATAAACTGTGGTGG - Intergenic
1010359750 6:74979007-74979029 ACATGGTTGATACAGTGTCCAGG + Intergenic
1014829300 6:126082637-126082659 ATACATTTGATAAAGTTTCCTGG - Intergenic
1020195632 7:6036124-6036146 ATAAGTGTGATAAAGTAGCCTGG - Exonic
1021289145 7:18822047-18822069 ATAAGGTTCAGAGAGTTTCCAGG - Intronic
1022093199 7:27121564-27121586 ATAAGGCTGATATGGTGTTCTGG - Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026929694 7:74217007-74217029 AGAAGGGAGAGAAAGTGTCCAGG + Intronic
1035742943 8:1942941-1942963 ATAAGGGTGATAAAATGTTCTGG + Intronic
1037702231 8:21285582-21285604 ATAAGGCTGATGAAGAGTCAGGG + Intergenic
1038110033 8:24486167-24486189 ATAAAGTTTAAAATGTGTCCTGG - Intronic
1039090250 8:33820362-33820384 AGAAGGTTGAAACAGTGCCCAGG + Intergenic
1041761411 8:61370681-61370703 ATAAGAATGATACAGTGGCCGGG - Intronic
1041828362 8:62124122-62124144 ATAAGGCTGAGAAACTTTCCTGG - Intergenic
1043997669 8:86838977-86838999 AGAAGGTTGATAAGTTGTGCAGG + Intergenic
1044043442 8:87399542-87399564 ATTAGGTTCATAAATTATCCAGG - Intronic
1044155700 8:88843706-88843728 ATGACGTTTATAAACTGTCCTGG + Intergenic
1044703198 8:94983164-94983186 ATGAAGTTAATAAAGTTTCCTGG + Intronic
1045526397 8:102944289-102944311 AAAAGGGTGATCAATTGTCCTGG - Intronic
1045941276 8:107741140-107741162 GGAAGATTGATGAAGTGTCCAGG - Intergenic
1046080514 8:109364802-109364824 ATCAGGTTGATAAAGACTCTTGG - Intronic
1046327307 8:112666286-112666308 GTAATTTTGATAGAGTGTCCAGG + Exonic
1056368471 9:85930122-85930144 ATAAAGTTGAAAAAGTCTCCTGG + Intergenic
1057386458 9:94609602-94609624 ATAGGGATGATGAAGTGTGCTGG - Intronic
1187537738 X:20158645-20158667 AAAAGGTTGCAAAACTGTCCAGG + Intronic
1187668523 X:21643930-21643952 ATAAGGATGATTAAGTATTCAGG - Intronic
1188637107 X:32447635-32447657 ATATGGTTAATAAAGTGTTCAGG - Intronic
1191196659 X:57731031-57731053 AGAAGGTAGACAAAGTGGCCAGG - Intergenic
1191646538 X:63487561-63487583 ATAAGGATGATAAAGGGGTCTGG - Intergenic
1192922279 X:75719570-75719592 ATTAGGTAAATAAAGTGACCAGG - Intergenic
1200962500 Y:9008309-9008331 ATGAGGTTGACACAGTGTCTCGG - Intergenic