ID: 1094332288

View in Genome Browser
Species Human (GRCh38)
Location 12:29307650-29307672
Sequence GCATCGTCTAACCACCTAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 1, 2: 1, 3: 0, 4: 29}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094332288_1094332289 17 Left 1094332288 12:29307650-29307672 CCTTTTAGGTGGTTAGACGATGC 0: 1
1: 1
2: 1
3: 0
4: 29
Right 1094332289 12:29307690-29307712 CACCCAAGCTGATCAGAGATTGG 0: 1
1: 0
2: 0
3: 1
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094332288 Original CRISPR GCATCGTCTAACCACCTAAA AGG (reversed) Exonic
910683110 1:89888080-89888102 GGATCCTCCAACCTCCTAAATGG - Intronic
919520549 1:198582580-198582602 GCATCATCTGGCCACCTATAGGG + Intergenic
923305437 1:232684007-232684029 GCATACTCTAAGCACCTTAAGGG + Intergenic
923955565 1:239014740-239014762 GGATCGTCAAACCAGTTAAAGGG + Intergenic
924280902 1:242436265-242436287 TCATCCTCTAATCATCTAAATGG + Intronic
1068284681 10:54919344-54919366 GCCTCATCTAACCAGCAAAAGGG + Intronic
1072830050 10:98647920-98647942 GAATCATCTAACCTACTAAAGGG + Intronic
1082797605 11:57389270-57389292 GCAGCGTCTTAGCACCCAAAGGG + Exonic
1093663870 12:21789370-21789392 TTATTTTCTAACCACCTAAAAGG - Intergenic
1094332288 12:29307650-29307672 GCATCGTCTAACCACCTAAAAGG - Exonic
1109504065 13:63275741-63275763 AAATTGTCTATCCACCTAAAAGG + Intergenic
1114120521 14:19666472-19666494 GCATCGTCTAACCACGTAAAAGG + Intergenic
1139069406 16:63361826-63361848 CCTTCATTTAACCACCTAAAGGG + Intergenic
925379597 2:3416170-3416192 GCATCTACTAAGCACCTAAGAGG - Intronic
938443368 2:131355584-131355606 GCGTCATCTAACCACCTAAAAGG - Intergenic
939185442 2:138855419-138855441 ATATTTTCTAACCACCTAAAAGG - Intergenic
948965119 2:241373358-241373380 GCAAAGTCTAACCAGCAAAATGG - Intronic
1172830107 20:37826386-37826408 GCATTGTCTAAGCACCTACTGGG - Intronic
1185023295 22:48393139-48393161 GCATCGTCTGCCCACACAAAGGG - Intergenic
956350540 3:68330366-68330388 GCTTCATCAAACCACATAAATGG + Intronic
962191545 3:133316250-133316272 CCATAGTCTCACCACTTAAAGGG - Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
991669455 5:69033278-69033300 GCACAGTATAAACACCTAAAGGG + Intergenic
999727518 5:154448549-154448571 GCAGCTTCTAACAACCTACACGG - Intronic
1009759207 6:67981352-67981374 GCATCACCTAACAACTTAAATGG + Intergenic
1013992560 6:116271438-116271460 GCATCTTGTAAGCATCTAAATGG + Intronic
1019725585 7:2600585-2600607 GCATCTGCTTAGCACCTAAAGGG - Intronic
1027220215 7:76209156-76209178 GTATAGTCTAACCCCCTCAAAGG - Intronic
1029946409 7:104537931-104537953 GGATTGTCTGACCACCTCAACGG + Intronic
1039094307 8:33866878-33866900 GCATCATCTAACCTGTTAAAGGG + Intergenic
1048480736 8:134790240-134790262 TCCTAGTCTAACCCCCTAAAAGG + Intergenic
1062175760 9:135161851-135161873 GCATCTTCCAAACACATAAATGG + Intergenic