ID: 1094333042

View in Genome Browser
Species Human (GRCh38)
Location 12:29317303-29317325
Sequence TATTATGTAAGATTACCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 809
Summary {0: 1, 1: 6, 2: 58, 3: 240, 4: 504}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094333042 Original CRISPR TATTATGTAAGATTACCTTC AGG Intronic
900073617 1:793858-793880 TACTGTATAAAATTACCTTCAGG + Intergenic
904793502 1:33041608-33041630 TATTGTATAAAATTACCTTCAGG + Intronic
905513024 1:38538458-38538480 TATTGCATAAAATTACCTTCAGG + Intergenic
906079813 1:43078056-43078078 TATTTTATAAAATTACATTCAGG + Intergenic
906106598 1:43297721-43297743 TATTGTTTAAAATTACCTTCAGG + Intergenic
906239170 1:44231098-44231120 GATTATATAAAATTACCTTCAGG - Intronic
906272654 1:44493178-44493200 TGTTGTGTAAAATTACCTTCAGG + Intronic
906849716 1:49235307-49235329 TATTATTTAAGATTAACTAATGG + Intronic
907105162 1:51876433-51876455 TATTGTATAAAATTATCTTCAGG - Intronic
907534294 1:55135485-55135507 TGTTGTATAAAATTACCTTCAGG + Intronic
907966766 1:59339101-59339123 TATTGTATAAAATTACCTTCAGG + Intronic
908033460 1:60026883-60026905 TATTGTATAAAATTACCTCCAGG + Intronic
908753940 1:67450513-67450535 TATTGTATGAAATTACCTTCAGG + Intergenic
908769011 1:67579232-67579254 TATTAGTTAAGGTCACCTTCAGG + Intergenic
908788383 1:67757181-67757203 AAGTATATAAAATTACCTTCAGG - Intronic
908966384 1:69769515-69769537 TATTGTATAAAATTACCTTCAGG + Intronic
908993070 1:70117363-70117385 ATTTATGTTTGATTACCTTCTGG - Intronic
909012465 1:70350444-70350466 TATTTGGCAAGATTACCTTCAGG - Intronic
909021276 1:70433943-70433965 TATTTTGTAAGTTTACCTTTAGG - Exonic
909160746 1:72146579-72146601 TATTGTGTAAAATTATCTCCAGG + Intronic
909592619 1:77368393-77368415 TATTGCATAAAATTACCTTCAGG - Intronic
909645443 1:77911639-77911661 TATTCTATAAAACTACCTTCAGG + Intronic
909716337 1:78711765-78711787 GATTTTGTAAGGTAACCTTCAGG + Intergenic
910071946 1:83226972-83226994 TATTGTATAAAATTACCTTCAGG - Intergenic
910145266 1:84072549-84072571 TATTGTGTAAAATTACCTTCAGG + Intergenic
910581213 1:88827438-88827460 TATTATATAAATTTACCTTCAGG - Intronic
910581991 1:88838889-88838911 TATTTTATAAAGTTACCTTCAGG - Intergenic
910729595 1:90379894-90379916 TATTGTGTAAAATTACCTCCAGG + Intergenic
911017385 1:93347167-93347189 TATTATCTAAGTTCAACTTCAGG - Intronic
911080091 1:93920197-93920219 TGTTATGTAAGATTGCCTGGAGG + Intergenic
911114597 1:94233723-94233745 TATTATGTAAAATTATTTCCTGG - Intronic
911633459 1:100208194-100208216 TATTGTATAAAATTACCTTTAGG + Intronic
911747562 1:101455961-101455983 AATTGTATAAAATTACCTTCAGG + Intergenic
911758171 1:101584744-101584766 TATTGTATAAAATTACCTTCAGG - Intergenic
911926675 1:103841514-103841536 TATTTTGTAAGCATCCCTTCTGG + Intergenic
912215430 1:107605712-107605734 TATTACATAAAATTACCTTCAGG + Intronic
912622455 1:111176733-111176755 TATTGTATAAAATTACCTTTGGG - Intronic
912673816 1:111657302-111657324 TATTGTATAAAATTACTTTCAGG + Intronic
913033933 1:114941847-114941869 TATTGTATTAAATTACCTTCAGG + Intronic
914860342 1:151380797-151380819 TATTGTATAAAGTTACCTTCAGG + Intergenic
916151814 1:161800324-161800346 TATTATATAAAATTACCTTCAGG - Intronic
916427191 1:164691937-164691959 TGTTATATAAAATTACCTTTAGG + Intronic
916665717 1:166965342-166965364 TATTATATAAAATTACCCTCAGG - Intronic
916994943 1:170286448-170286470 TATTGTATAAAATTACCTTTAGG + Intergenic
917758560 1:178130434-178130456 GATTATGTAAGATTTTCTACGGG - Intronic
917813249 1:178681157-178681179 TATTGTATAAAATTACCTTCAGG + Intergenic
917996772 1:180447596-180447618 TATCATGGAAAACTACCTTCAGG + Intronic
918092001 1:181305042-181305064 TATTGTATAGAATTACCTTCAGG - Intergenic
918337427 1:183532376-183532398 AATTATTTTAGATTACCTGCAGG - Intronic
918598912 1:186329514-186329536 TATTGTGTCAGATTAACTTCAGG - Intronic
918829899 1:189381552-189381574 TATTATGAAAGATTACAATGGGG - Intergenic
918866657 1:189909186-189909208 TATTGTATAAAATTACCTCCAGG - Intergenic
919051830 1:192520922-192520944 TATTGTATAAAATTATCTTCAGG + Intergenic
919139409 1:193551643-193551665 TATTCTATAAAATCACCTTCAGG + Intergenic
919660812 1:200243793-200243815 TATTGTATAAAATTACCTTCAGG - Intergenic
919770135 1:201153395-201153417 TATTGTATAAAATTACCTTCGGG + Intronic
920659777 1:207905801-207905823 TATTGTCTAAAATTATCTTCAGG + Intronic
920840825 1:209552275-209552297 TACTGTATAAAATTACCTTCAGG - Intergenic
920946562 1:210534640-210534662 TATGGTATAAAATTACCTTCAGG - Intronic
921040241 1:211424084-211424106 TATTGTATAAAATTATCTTCTGG + Intergenic
921340682 1:214130943-214130965 TATTGTCTAACATTACCTTCAGG - Intergenic
921447929 1:215268583-215268605 TATTATATGAAGTTACCTTCAGG - Intergenic
921463408 1:215456003-215456025 TATTGTATAAAATTACCTTCAGG - Intergenic
921591246 1:217006689-217006711 TATTGTATAAAATTACCTTTAGG - Intronic
922113109 1:222582021-222582043 TATTATATAAAATTACCTTCAGG - Intronic
922269477 1:224018765-224018787 TACTGTATAAAATTACCTTCAGG + Intergenic
922273071 1:224052074-224052096 TACTGTATAAAATTACCTTCAGG + Intergenic
922303894 1:224327500-224327522 TATTGTGTAAGACTATCTTCAGG + Intronic
923172133 1:231427706-231427728 TATTGTATAAAATTACTTTCAGG - Intergenic
923836961 1:237622448-237622470 TATTTTATAAAATTTCCTTCAGG + Intronic
924200616 1:241654832-241654854 TATTGTATAAAATTACCTCCAGG + Intronic
924544356 1:245011144-245011166 TACTACATAAAATTACCTTCAGG - Intronic
924616537 1:245616590-245616612 TATTGTATAAAGTTACCTTCAGG - Intronic
924617384 1:245623699-245623721 TATTGTCTAAGATTATCTTCAGG + Intronic
924829321 1:247576138-247576160 TATTGTATAAAATTACCTTCAGG - Exonic
1063633820 10:7761663-7761685 TATTGTATAAAATTACCTTCAGG + Intronic
1064669210 10:17691976-17691998 AAGTATGTAACATTACCTCCGGG - Intronic
1064763384 10:18645339-18645361 TATTGTATAAAATTACCTTCAGG + Intronic
1064831026 10:19466815-19466837 TATTGTATAAAATTACCTTCAGG - Intronic
1065047216 10:21755095-21755117 TATTGCATAAAATTACCTTCAGG + Intergenic
1065129564 10:22606963-22606985 TATTGTATAAAATTACCTTTAGG - Intronic
1065585300 10:27211867-27211889 TCTTATCTAAGGTTTCCTTCAGG + Intronic
1065661912 10:28013016-28013038 TATTAATTAAGATTAGGTTCCGG + Intergenic
1066358594 10:34709223-34709245 TATTGTATAAAATTACCTTCTGG - Intronic
1068255781 10:54508963-54508985 TATCATTTAAAATTACCTTTAGG - Intronic
1068539800 10:58279195-58279217 TATTGTATAAAATTACTTTCAGG + Intronic
1068898460 10:62235630-62235652 TATCATGGAAAATTACCTTCAGG + Intronic
1069008272 10:63342872-63342894 TATTATTTAAAATTACCTTCAGG + Intronic
1069324603 10:67217982-67218004 TGTTGTATAAAATTACCTTCAGG + Intronic
1069377138 10:67804659-67804681 TATTATAGAAGTTTACCTCCTGG - Intronic
1071447848 10:85765584-85765606 TATTCTATAAAATTACCTTCAGG + Intronic
1071819631 10:89266471-89266493 TATTATATAAAATTACCTTCGGG + Intronic
1072062364 10:91826174-91826196 TGTTATATAAAATTATCTTCAGG - Intronic
1072593736 10:96852109-96852131 TATTGTATAAAATTACCTTTAGG + Intronic
1072770904 10:98136508-98136530 TACTATATAAAATTACCTTTAGG - Intronic
1072988360 10:100164811-100164833 TATTTTATAAAGTTACCTTCAGG + Intronic
1073766950 10:106693019-106693041 TATTGTTTAAAATTACCTTCAGG + Intronic
1073771719 10:106742367-106742389 AATTGTGTAAAATTATCTTCTGG - Intronic
1073965484 10:108984282-108984304 TGTTGTATAAAATTACCTTCAGG - Intergenic
1074839580 10:117336117-117336139 TTTTGTATAAAATTACCTTCAGG - Intronic
1074944553 10:118268874-118268896 TATTTTATAAGATTACCTTTGGG - Intergenic
1075027895 10:119000274-119000296 TATTATGAAAGATTAGCTAGAGG + Intergenic
1078813263 11:14793356-14793378 TATTATATAAAATCACGTTCAGG - Intronic
1079439913 11:20501649-20501671 TATCTTGTCATATTACCTTCTGG - Intronic
1080355305 11:31437292-31437314 TACTGTATAAAATTACCTTCAGG - Intronic
1080357069 11:31461645-31461667 TAGTGTATAACATTACCTTCAGG + Intronic
1081010734 11:37809156-37809178 CATTATGTAAAATTAAATTCTGG + Intergenic
1081805707 11:45889181-45889203 TATTGTATAAAATTACCTTGAGG - Intronic
1083157428 11:60832963-60832985 GATAATGTAAAATTACTTTCTGG - Intergenic
1084342593 11:68516379-68516401 TATTGTGTAAAATTACCTTTAGG + Intronic
1084674753 11:70627716-70627738 TGTTGTATAAAATTACCTTCAGG - Intronic
1085137987 11:74111441-74111463 TATTGTATAAAATTACCTTCAGG + Intronic
1085177055 11:74498457-74498479 TATTGTATGAAATTACCTTCAGG + Intronic
1086326086 11:85701309-85701331 TGTTATATAAAATTACCTTCAGG - Intronic
1086334844 11:85790094-85790116 TATTATAAAAAATTACCTTCAGG - Intronic
1086348659 11:85923290-85923312 TAGTATATAAACTTACCTTCAGG + Intergenic
1086547063 11:88010000-88010022 TATTATATAAAATTACCTTCAGG - Intergenic
1086725294 11:90174955-90174977 TATTATGTAAAATTAAGTTTAGG + Intronic
1087213931 11:95474262-95474284 TATTGTGTAAAATTACCTCTAGG - Intergenic
1087313481 11:96577833-96577855 TATAATGTAGGATTCCCCTCTGG + Intergenic
1087745241 11:101937103-101937125 TATTACATAAAATTACCTTTAGG - Intronic
1087748999 11:101985226-101985248 TATTATATAAAATTACCTTCAGG + Intronic
1087884052 11:103456873-103456895 TATTATATAAAATTACCTTTGGG + Intronic
1088045150 11:105442034-105442056 TATTTTATAAAATTACCTTCAGG - Intergenic
1088142446 11:106633664-106633686 TATTATGAAACAGTACCTTTAGG - Intergenic
1088227084 11:107633018-107633040 TGTTGTATAAAATTACCTTCAGG + Intronic
1088312446 11:108474494-108474516 TATTATATAAAATTACCTTCAGG + Exonic
1088345095 11:108815161-108815183 TTTGATGTAACATTACCTTTTGG + Intronic
1088434241 11:109793411-109793433 TATTTTATAAAATTACCTTTGGG + Intergenic
1088519017 11:110674541-110674563 TATTATATAAAATTACCCTCAGG + Intronic
1089142654 11:116299604-116299626 TAGTATGTAAGATTATTTTGTGG + Intergenic
1089787242 11:120916711-120916733 TATTGTATGAAATTACCTTCAGG + Intronic
1089925476 11:122252976-122252998 TATTGTATAAAATTACCTTTAGG + Intergenic
1090077574 11:123588984-123589006 TATTATATAAAATTATCCTCAGG - Intronic
1090176671 11:124656016-124656038 TATTGTACAAAATTACCTTCAGG + Intronic
1090301739 11:125647783-125647805 CATTGTATAAAATTACCTTCAGG - Intronic
1090510792 11:127372858-127372880 TATTATATAAAATCACCTTCAGG + Intergenic
1090686253 11:129124216-129124238 TGTTGTATAACATTACCTTCAGG - Intronic
1091572875 12:1705516-1705538 CATTGTATAAAATTACCTTCAGG + Intronic
1091896859 12:4112073-4112095 TATTTTCTAAAATTACCTTCAGG + Intergenic
1091927253 12:4363626-4363648 TATTGTGCAAAATTACCTTCAGG + Intergenic
1092038263 12:5360495-5360517 TATTGTATAAAATTACCTTCAGG - Intergenic
1092259459 12:6945010-6945032 TATTATATAAAATTACCCTCAGG - Intronic
1092601903 12:10076034-10076056 TATTATGTAAGATAATTTTGAGG - Intronic
1093189722 12:16060149-16060171 TATTGTATAAAATTACCTTCAGG + Intergenic
1093718211 12:22408194-22408216 TATTTTATAAAATTATCTTCAGG + Intronic
1094194863 12:27738257-27738279 TATTGTGTAAAATTACCTTTAGG - Intronic
1094245229 12:28283733-28283755 TATTGTATAAAATTACATTCAGG - Intronic
1094333042 12:29317303-29317325 TATTATGTAAGATTACCTTCAGG + Intronic
1094562444 12:31568191-31568213 TACTGTATAAAATTACCTTCAGG + Intronic
1094646711 12:32331591-32331613 AATTGTATAAAATTACCTTCAGG - Intronic
1095799645 12:46258475-46258497 TATTATGTAAAATTGCCTTTAGG - Intronic
1095890299 12:47229590-47229612 TATTGTATAAAATTACCTTCAGG - Intronic
1096236482 12:49931344-49931366 TATTTTATAAAATTACCTTTGGG - Intergenic
1096418522 12:51435144-51435166 TATTTGGTAAGATTACCTCATGG + Intronic
1097292192 12:57926949-57926971 TATTGTGTAAAATTACCTTCAGG - Intergenic
1097637065 12:62135789-62135811 TATTAGGAAAGCTTACCTTTTGG + Intronic
1097718515 12:62994738-62994760 TATTGTATAAAATTACCTTCAGG - Intergenic
1097784239 12:63741337-63741359 TATTCTGAAACATTACCATCTGG - Intergenic
1098125793 12:67291621-67291643 TATCATATAAAATTACCTTCGGG - Intronic
1098594627 12:72257339-72257361 TATTATATTAAATTAACTTCAGG + Intronic
1098863989 12:75741416-75741438 CATTAAATAAAATTACCTTCAGG + Intergenic
1099068504 12:78014810-78014832 TATTATGTAGAAGTAGCTTCAGG - Intronic
1099148992 12:79085021-79085043 TATTGTATAAAATTATCTTCAGG - Intronic
1099220101 12:79903463-79903485 AATCATATAAAATTACCTTCAGG + Intronic
1099531096 12:83782291-83782313 TATTATATAAAGTTACCTTCAGG - Intergenic
1099646877 12:85368627-85368649 TATTGTATTAAATTACCTTCAGG - Intergenic
1099690703 12:85947822-85947844 TATTAATCAAGATTACCTTTAGG + Intergenic
1099897186 12:88663097-88663119 TATTATGTAATATAAGTTTCTGG + Intergenic
1100223042 12:92526984-92527006 TATTGTATGAAATTACCTTCAGG + Intergenic
1100408576 12:94292695-94292717 AATTATATAAAATTACCTTCAGG - Intronic
1101969861 12:109305393-109305415 TATTATGTTATTTTGCCTTCTGG + Intronic
1102289842 12:111690316-111690338 TATTGTATAAAATTACCATCAGG - Intronic
1102649439 12:114428361-114428383 TATTGTATAAATTTACCTTCAGG + Intergenic
1102829332 12:115982108-115982130 TATTGTATAAAATTACCTTCAGG + Intronic
1102832212 12:116013430-116013452 CATTGTATAAAATTACCTTCAGG + Intronic
1102834079 12:116037357-116037379 TATTGTATAAAATAACCTTCAGG + Intronic
1102835267 12:116051701-116051723 TATTGTGCAAAATTACCTTCAGG - Intronic
1102836738 12:116069812-116069834 TATTGTATAAAACTACCTTCAGG + Intronic
1102945584 12:116985014-116985036 TATTGTATAAAATTACCTTCAGG + Intronic
1105044365 12:132989583-132989605 TACTGTATAAAATTACCTTCAGG - Intronic
1105440719 13:20413663-20413685 TATTATATAAAATTACTTTCAGG - Intronic
1105572793 13:21619921-21619943 TATTTTGTAATATTAAGTTCTGG - Intergenic
1105592227 13:21803221-21803243 TATTGTTTAAAATTACCTTCGGG - Intergenic
1105961685 13:25347079-25347101 TATTGTATAATATTACCCTCAGG - Intronic
1105979789 13:25506753-25506775 TATTGTATAAAATAACCTTCAGG - Intronic
1106064655 13:26333640-26333662 TATTATATAAAATTACCTTCAGG + Intronic
1106328071 13:28713891-28713913 TATTGTATAAAATTACCTTCAGG - Intronic
1106456014 13:29927818-29927840 TATTGTATAAAATTACCTCCAGG - Intergenic
1106890734 13:34242692-34242714 TGTTCTATAAAATTACCTTCAGG - Intergenic
1107062691 13:36176613-36176635 TATTGTATAAAATTTCCTTCAGG - Intronic
1107114990 13:36737351-36737373 TATCATATAAAATTACCTTCAGG + Intergenic
1107346807 13:39470617-39470639 TATTATGGAAGATTAATTTATGG - Intronic
1107605901 13:42056408-42056430 TATTATGCTAAATTACATTCTGG - Intronic
1108002591 13:45917823-45917845 TATTGTGTAAAATTACCTCTAGG - Intergenic
1108294340 13:48998443-48998465 TACTATGTAAAATTACCTTCTGG + Intronic
1109172564 13:59114810-59114832 TATTGTATAAAATTACCTTTAGG - Intergenic
1109271231 13:60258072-60258094 TATTGTATAAAATTACCTTCAGG + Intergenic
1109410018 13:61951298-61951320 TATTGTATAAAATTACCTTCAGG + Intergenic
1109682095 13:65764763-65764785 TATTATGGAGAATTGCCTTCTGG - Intergenic
1109696352 13:65964366-65964388 GATTATGTATAAATACCTTCAGG - Intergenic
1109927498 13:69163817-69163839 TATTATGTAAAATTACCTTCAGG - Intergenic
1110282281 13:73708269-73708291 TATTATACAGGATTACCTACTGG + Intronic
1110435757 13:75476306-75476328 TATTGTATAAAATTACCTTGAGG - Intronic
1110752063 13:79126107-79126129 TATTAAATATGATTAGCTTCTGG + Intergenic
1110837272 13:80098164-80098186 TACTATGTAAAATAACCTTCAGG - Intergenic
1111009198 13:82289909-82289931 GATTATGAAATATTACCTTATGG - Intergenic
1111028122 13:82561189-82561211 TATTTTATACCATTACCTTCAGG + Intergenic
1111060666 13:83014756-83014778 CATTATATAAGATTACCTAGAGG + Intergenic
1111533391 13:89570356-89570378 TATTATATAAAATTACCTTTAGG + Intergenic
1111537056 13:89615824-89615846 TATAATGTAAGAATATCTCCAGG + Intergenic
1111541610 13:89674889-89674911 TATTATATTAAATTATCTTCAGG + Intergenic
1111660541 13:91204684-91204706 TCTTGTGTAAAATTATCTTCAGG + Intergenic
1111764727 13:92513794-92513816 TATGGTATAAAATTACCTTCAGG - Intronic
1112296810 13:98195088-98195110 TATTATGTAAAATCACTTTGTGG + Intronic
1112935086 13:104787153-104787175 TATTACATAAAATTACCTTCAGG - Intergenic
1113715062 13:112498396-112498418 AAATATATAAAATTACCTTCAGG - Intronic
1113746412 13:112748062-112748084 TATTGTATAAAATTACCATCAGG + Intronic
1114034921 14:18614856-18614878 TATTGTATAAGATTACCTTCAGG + Intergenic
1114123725 14:19700160-19700182 TATTGTATAAGATTACCTTCAGG - Intergenic
1114936299 14:27541697-27541719 TACTATATAAAATTATCTTCAGG - Intergenic
1115369431 14:32595362-32595384 TATAATGTAGGATTATCTTCAGG + Intronic
1115732874 14:36290497-36290519 TATTGTACAAAATTACCTTCAGG + Intergenic
1115746619 14:36444312-36444334 TATTGTCTAAAATTACCTTCAGG - Intergenic
1116339699 14:43705425-43705447 TATTATATAAAATTAATTTCTGG + Intergenic
1116399740 14:44491699-44491721 TATTATATCAAATTACCTTCAGG + Intergenic
1116627510 14:47284488-47284510 TAGTAGGTAAGATGGCCTTCAGG + Intronic
1116926640 14:50645448-50645470 TATTATGTAAAATTACCTTCAGG + Intronic
1117064551 14:51998217-51998239 TATTATATGAAATTACCTTCAGG + Intronic
1117393680 14:55287229-55287251 TATTGTATAAAACTACCTTCAGG - Intronic
1117696382 14:58368790-58368812 ATTTATATAAAATTACCTTCAGG - Intronic
1118183590 14:63518755-63518777 TATGATGGAAGATTACTTTGAGG - Intronic
1118246709 14:64117632-64117654 TATTATATAAAATAACCTTCAGG - Intronic
1118392872 14:65310459-65310481 TATTGTACAAAATTACCTTCAGG + Intergenic
1118624072 14:67641191-67641213 TATTATATAAAATTACCTTCAGG + Intronic
1119063850 14:71505843-71505865 TATTGTATGAAATTACCTTCAGG + Intronic
1119271925 14:73313542-73313564 TATTGTATAAAATTATCTTCAGG + Intronic
1120085346 14:80265887-80265909 TATTGCATAAAATTACCTTCAGG - Intronic
1120815606 14:88854659-88854681 TATTATACAAAATTACCTTCAGG - Intronic
1120929589 14:89835413-89835435 TATTATATAAAATTACCTTCAGG - Intronic
1120937134 14:89908500-89908522 TATTGTATAAAATTACCTTCAGG + Intronic
1121002127 14:90459260-90459282 TATGATGTAAGATATCCTCCAGG + Intergenic
1121201173 14:92119745-92119767 TTTCATATAAGATTACCTTCAGG - Intronic
1121364694 14:93298458-93298480 TATTGTATAAAATTACCTTCAGG + Intronic
1121373088 14:93378598-93378620 TATTGTATAGAATTACCTTCAGG - Intronic
1121749829 14:96342384-96342406 TATTGTATAAAATTACCTTCAGG + Intronic
1122299018 14:100721549-100721571 TTTTATGGAAAATTAACTTCTGG + Intergenic
1122588480 14:102827477-102827499 TATTGCATAAAATTACCTTCAGG - Intronic
1202901420 14_GL000194v1_random:43526-43548 TATTATATAAAATTACCTGTAGG + Intergenic
1123460758 15:20468238-20468260 TGCTATATAAAATTACCTTCAGG - Intergenic
1123657303 15:22532178-22532200 TGCTATATAAAATTACCTTCAGG + Intergenic
1124066882 15:26353203-26353225 TATTGTATAAAATTGCCTTCAGG + Intergenic
1124311215 15:28627387-28627409 TGCTATATAAAATTACCTTCAGG + Intergenic
1125025213 15:35022906-35022928 TTTTTTGCAAGAATACCTTCAGG + Intergenic
1125189911 15:36979204-36979226 CATTGTATAAAATTACCTTCAGG + Intronic
1125271891 15:37948651-37948673 TCTTTTCTAAGATTTCCTTCAGG - Intronic
1125737568 15:41938030-41938052 TGTTCTGTAAAATTACCTTTAGG - Intronic
1126405898 15:48322025-48322047 TACTGTATAAAATTACCTTCAGG - Intergenic
1127938439 15:63667737-63667759 TATTTTTAGAGATTACCTTCTGG - Intronic
1128124279 15:65180598-65180620 TATTATATAAGAATACTATCTGG + Intronic
1128210199 15:65893568-65893590 TATTGTATAAAATTACCTTTAGG + Intergenic
1128498774 15:68212849-68212871 TGTTATATAAAATTAACTTCAGG - Intronic
1128807608 15:70543308-70543330 TATTGTATAAGAATACCTTCAGG + Intergenic
1129258155 15:74346014-74346036 TATTTTGTAATAGTACCTTTTGG - Intronic
1130294212 15:82632320-82632342 TATTGTATAAAATTAACTTCAGG - Intronic
1130934468 15:88457011-88457033 TATTGTATAAAATTACCTTCGGG + Intergenic
1131313132 15:91308788-91308810 TATTATGTAAAATTACATTTAGG - Intergenic
1131368863 15:91863131-91863153 TATTATGTAAGATTCAATTATGG + Intronic
1131637785 15:94256210-94256232 TATTGTATAAAATTACCTTTAGG + Intronic
1131708826 15:95029960-95029982 TTTTCTGGAGGATTACCTTCTGG - Intergenic
1132088099 15:98924235-98924257 CATTGTGTAAGATAACCTTGTGG + Intronic
1134379683 16:13712330-13712352 GGTTATGAAAGATTTCCTTCTGG - Intergenic
1134816303 16:17208541-17208563 TATTGTATAAAATTACTTTCAGG - Intronic
1135508054 16:23056193-23056215 TCTTATGTAAGATGACCTGAAGG + Intergenic
1135813649 16:25612220-25612242 TGTTGTGTAAAACTACCTTCAGG - Intergenic
1135982838 16:27161870-27161892 TACTATATAAAATTACCTTCAGG - Intergenic
1136157759 16:28395948-28395970 TACTATGTAAAATTGCCATCAGG - Intronic
1136205328 16:28719336-28719358 TACTATGTAAAATTGCCATCAGG + Intronic
1137366901 16:47867965-47867987 TATTATATAAAATTACCTTCAGG + Intergenic
1139382345 16:66541109-66541131 TATTGTATAAAATTACCTTCAGG + Intronic
1140152619 16:72386069-72386091 TGTTACATAAAATTACCTTCAGG - Intergenic
1140348363 16:74236994-74237016 TATTGTATAAAATTACCTGCAGG - Intergenic
1140755742 16:78065058-78065080 TATTCTATAAAATTAGCTTCAGG + Intronic
1143703201 17:8676794-8676816 TATTATATCAAATTATCTTCAGG - Intergenic
1143921661 17:10335231-10335253 TATTGTATAAAATTACCTTAGGG + Intronic
1144118138 17:12121179-12121201 TATAATATAAAATTACCTTCAGG + Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1147214134 17:38889619-38889641 TATTGTATAAAATTACCTTCAGG + Intronic
1147291547 17:39447458-39447480 TGTTGTATAAAATTACCTTCAGG + Intronic
1148292313 17:46464546-46464568 TATTGTACAGGATTACCTTCAGG - Intergenic
1149017741 17:51928200-51928222 TATTGTATATAATTACCTTCAGG - Intronic
1149247570 17:54728674-54728696 TTTTATGTAAGAGGACATTCTGG - Intergenic
1149274954 17:55023429-55023451 CATTATATAAAATTACTTTCAGG - Intronic
1149402379 17:56311717-56311739 TGTTGTATAAAATTACCTTCAGG + Intronic
1150000191 17:61430780-61430802 CATTGTATAAAATTACCTTCAGG - Intergenic
1150153052 17:62826357-62826379 TATTGAATAAAATTACCTTCAGG + Intergenic
1151138953 17:71973566-71973588 TATTTTACAAAATTACCTTCAGG + Intergenic
1151328111 17:73391256-73391278 CAGTGTGTAAGATTATCTTCCGG - Intronic
1152443061 17:80321202-80321224 TATTGTATAAAATTACCTTCAGG - Intronic
1153018911 18:609143-609165 TATTGTGTAAATTTACCTTCAGG - Intronic
1153032539 18:728371-728393 AATTATGTAAAATTACCTTCAGG - Intronic
1153128156 18:1821495-1821517 TATCATATAAAATTACCTTCAGG - Intergenic
1153398701 18:4656491-4656513 TATTATATAAAATTACCTACTGG + Intergenic
1153662536 18:7338108-7338130 TATTCTGTATAATTATCTTCAGG + Intergenic
1153745553 18:8175484-8175506 TATTAAGAAACAGTACCTTCTGG - Intronic
1155109969 18:22704969-22704991 TATTGTATAATCTTACCTTCAGG - Intergenic
1155367729 18:25065397-25065419 TATTGTGTAAAATGACCTTTGGG + Intronic
1155716506 18:28951011-28951033 TATTTTTTAAGATTACCAGCAGG - Intergenic
1155863252 18:30931563-30931585 TATTATGTAAAGTTACCTTTAGG - Intergenic
1156153377 18:34270247-34270269 TATTGTATAAAATTACCTTCAGG + Intergenic
1156224549 18:35091290-35091312 TACTGTATAAAATTACCTTCAGG + Intronic
1157022114 18:43796546-43796568 TATTACATAAAATTACCTTCAGG + Intergenic
1157051023 18:44164684-44164706 TATTATGTAAAATAACACTCAGG - Intergenic
1157317697 18:46606532-46606554 TACTGTGTAGAATTACCTTCAGG + Intronic
1157879063 18:51302330-51302352 TCTTGTATAAAATTACCTTCAGG - Intergenic
1158089435 18:53693646-53693668 TATTATATAACATTACCTGCAGG - Intergenic
1158318559 18:56238378-56238400 TATTGTATAAAATTACCTTTAGG + Intergenic
1158584944 18:58724670-58724692 TATTGTATAAAATTACCTTCAGG + Intronic
1158926531 18:62269506-62269528 TATTGTATAAAATTACCTTCAGG - Intronic
1160189758 18:76706049-76706071 TATTATATAAAGTTATCTTCAGG - Intergenic
1164961210 19:32431682-32431704 TATTGTATAAAATCACCTTCAGG - Intronic
1166728396 19:45043030-45043052 TATTGTATACAATTACCTTCAGG + Intronic
1167732179 19:51266389-51266411 TATTATATAAAATTACCTTCAGG + Intronic
1167791454 19:51685496-51685518 TATTGTATAAAATTATCTTCAGG - Intergenic
1168394218 19:56034420-56034442 TAGTATGTAAGATTAACCACTGG - Intronic
925707057 2:6696012-6696034 TATTGTATAAAATTACATTCAGG - Intergenic
926257178 2:11215634-11215656 CATTATTTCAGATTACCTTACGG - Exonic
926659697 2:15450927-15450949 TCTTATGGAAGACAACCTTCTGG + Intronic
927037824 2:19198990-19199012 TATTGTATAAAATTATCTTCGGG - Intergenic
927394817 2:22637777-22637799 TATCATTTAAAATTATCTTCAGG - Intergenic
927530781 2:23797721-23797743 CATTGTATAAAATTACCTTCAGG - Intronic
928496284 2:31835875-31835897 TATTATATAAAATTACCTTCAGG - Intergenic
929255257 2:39803666-39803688 TATTCTTTAAAATTTCCTTCTGG + Intergenic
929475051 2:42238074-42238096 TACTGTATAAAATTACCTTCGGG + Intronic
929848316 2:45555958-45555980 TATTAATTAATATTACCTTAAGG + Intronic
930357450 2:50339785-50339807 TTTTATCTAATATTACCTTGTGG - Intronic
930464188 2:51724318-51724340 TATTGTATAAAGTTACCTTCAGG - Intergenic
930502403 2:52238052-52238074 TATTGTATAAGATTACCTTCAGG - Intergenic
930779356 2:55208316-55208338 TATTATATAAAATTGCCTTCAGG - Intronic
931533682 2:63247568-63247590 TATTATATAAAATTGCCTTCAGG + Intronic
931806957 2:65816819-65816841 CATTCTGTAAGATCAGCTTCTGG + Intergenic
931857692 2:66320441-66320463 TATTGTATAAAATTACCTTCAGG + Intergenic
932069531 2:68604901-68604923 AATTATGGAAGCATACCTTCAGG + Intronic
932431546 2:71678145-71678167 TATTCTATAAAATTCCCTTCAGG - Intronic
932553685 2:72798865-72798887 TATTATCTCATATTACCATCAGG - Intronic
933392251 2:81686036-81686058 CATTATATAAAATTACCTTCAGG - Intergenic
934082303 2:88479451-88479473 TATTTTATAAAATTACCTTCGGG + Intergenic
934505352 2:94887594-94887616 TATTATATAAAATTACCTTTAGG - Intergenic
934865672 2:97808129-97808151 TGTTGTATAAAATTACCTTCAGG - Intronic
935442404 2:103116401-103116423 TATTGCATAAAATTACCTTCAGG + Intergenic
935576795 2:104719280-104719302 TATTATGTTCTATTACTTTCAGG + Intergenic
935704407 2:105843225-105843247 TATTATATGAAATTACCTTCGGG - Intronic
935898934 2:107769750-107769772 AATTATATAAAATTACCTTCAGG + Intergenic
936069916 2:109360441-109360463 TGTTGTATAAAATTACCTTCAGG + Intronic
936599739 2:113884139-113884161 TATTGTATAAAATTACCTTCAGG + Intergenic
936827241 2:116597467-116597489 TATTATATAAAATTACCTCCAGG + Intergenic
937172049 2:119883226-119883248 TATTATATAATATTACCTTCAGG + Intronic
937546378 2:123026582-123026604 TACTGTATAAAATTACCTTCAGG - Intergenic
937761341 2:125606656-125606678 TATTGTATAAAATCACCTTCAGG - Intergenic
937777449 2:125795922-125795944 TATTATATAAAATTACTTTCAGG - Intergenic
938276330 2:130027993-130028015 TATTGTATAAGATTACCTTCAGG - Intergenic
938327288 2:130418754-130418776 TATTGTATAAGATTACCTTCAGG - Intergenic
938362651 2:130702723-130702745 TATTGTATAAGATTACCTTCAGG + Intergenic
938439046 2:131309363-131309385 TATTGTATAAGATTACCTTCAGG + Intronic
938660768 2:133484697-133484719 TACTATATAAAATTACCTTCAGG + Intronic
938776813 2:134548791-134548813 TATTGTATAAGATTACCTTCAGG - Intronic
939320136 2:140609330-140609352 TATTATTTAAGGTTTCCTTTAGG + Intronic
939723988 2:145691551-145691573 TCTCATGTAAGATTACATACTGG + Intergenic
940157503 2:150674734-150674756 TATTTTATAAAATTACCTTCAGG + Intergenic
940428706 2:153561444-153561466 TATTTTATAAAATTACCTTCAGG - Intergenic
940598426 2:155825248-155825270 TATTATACAAAATTACTTTCAGG + Intergenic
940700015 2:157028881-157028903 TATTGTATAAAATTACCTTCTGG + Intergenic
940780405 2:157927272-157927294 TGTTGTATAAAATTACCTTCAGG - Intronic
940901477 2:159130254-159130276 TATTATGTAGTATTACATTCTGG + Intronic
940963400 2:159810978-159811000 TATTATTTCAGAGTACTTTCAGG - Intronic
940984023 2:160034996-160035018 TATTGTATAAAATTACCTTCAGG + Intronic
941050769 2:160731045-160731067 TATTTTGTAAGTTTTCCTGCAGG + Intergenic
941078889 2:161037248-161037270 TTTTATGGAAGATTTCCTTAAGG + Intergenic
941153811 2:161949825-161949847 TAGTGTATAAAATTACCTTCAGG - Intronic
941235668 2:162969764-162969786 TATTATATCAAATTTCCTTCAGG - Intergenic
941426522 2:165352708-165352730 TATTGTATAATATTACCTTCAGG + Intronic
941827798 2:169919290-169919312 GTTTAAGTAAGACTACCTTCTGG + Intronic
941979955 2:171444450-171444472 TATTATGTAAAATTATCTTCAGG + Intronic
942208120 2:173643420-173643442 TATTGTATAAAATTACCTTCAGG + Intergenic
942208280 2:173645632-173645654 TATTGTATAAAATTACCTTCAGG + Intergenic
942575611 2:177360609-177360631 TTTTATGGAAAAATACCTTCTGG + Intronic
942581070 2:177417284-177417306 TATTGTATAAAATTACCTTCAGG + Intronic
942696549 2:178653134-178653156 TATTAGGTAAAATTACATTTAGG + Intronic
942820083 2:180103255-180103277 TATTGTATAAAATGACCTTCAGG + Intergenic
942895121 2:181043421-181043443 TATTGTATAAAATTACTTTCAGG + Intronic
942920247 2:181364383-181364405 TATTATGTAATATAAACTGCAGG + Intergenic
942935498 2:181551769-181551791 TATTATATAAAATTATCTTCAGG - Intronic
943100138 2:183478322-183478344 TATTGTATAAAATTACTTTCAGG + Intergenic
943203165 2:184856725-184856747 TATTATATAAAATCACCTTCAGG + Intronic
943503013 2:188715658-188715680 TATTGTATAAAATTACCTTTAGG - Intergenic
944342509 2:198619383-198619405 TAATATATAAAATTACTTTCAGG - Intergenic
944554124 2:200870959-200870981 TATTGTGTAAAATTACCTTCAGG - Exonic
945131109 2:206573401-206573423 TATTACATAAAATTACCTTCAGG - Intronic
945147093 2:206749710-206749732 TGTTGTATAAAATTACCTTCAGG - Intronic
945226674 2:207538014-207538036 TTTTGTATAAAATTACCTTCAGG - Intronic
945312327 2:208328696-208328718 TCTTATATAAAATTAACTTCAGG - Intronic
945677608 2:212874849-212874871 GATTGTCTAAGATTACTTTCAGG + Intergenic
945712036 2:213309011-213309033 TATTGTATAAAATTACCTTCAGG - Intronic
945829152 2:214762198-214762220 TATTGTATAAAATTACCTTCAGG + Intronic
946796647 2:223361530-223361552 TAATTTGTCAGATTACTTTCTGG + Intergenic
947175465 2:227362626-227362648 TATTGTGTGAAATTACCTTCAGG + Exonic
1169365577 20:4989483-4989505 TATTGAGTAGAATTACCTTCAGG - Intronic
1169713667 20:8592045-8592067 TAGTGTATAAAATTACCTTCAGG - Intronic
1169793399 20:9436093-9436115 TATTGTATAAAATTACCTTCAGG + Intronic
1169949705 20:11030479-11030501 TATTGTATAAAATTTCCTTCAGG - Intergenic
1170235383 20:14097828-14097850 TATTGTATAAAAATACCTTCAGG - Intronic
1170248268 20:14248611-14248633 TATTGTGTAAAATTACCCTCAGG + Intronic
1170653680 20:18266249-18266271 TATTGTATAAAATTACCTTCAGG - Intergenic
1170669913 20:18422566-18422588 TATTATATAAAATTACCTTCAGG + Intronic
1170754069 20:19182216-19182238 TATTGTATAAAATTACTTTCCGG + Intergenic
1171394214 20:24820813-24820835 TATTATATAAAATTACCTTCAGG + Intergenic
1172733010 20:37104329-37104351 TATTGTATAAAATTACCTTCAGG - Intronic
1173990787 20:47301746-47301768 TATTGTATAAAATTACCTTCAGG + Intronic
1174026544 20:47581154-47581176 TATTATATAAAATTACCTTCAGG + Intronic
1176359753 21:5984784-5984806 TACTATATAAAATTACCTTCGGG - Intergenic
1176620795 21:9058304-9058326 TATTATATAAAATTACCTGTAGG + Intergenic
1176696832 21:9988227-9988249 TCTTATGTAAGATTAACTTATGG + Intergenic
1177589805 21:23147954-23147976 TATTTTATAAAATTATCTTCAGG - Intergenic
1177682367 21:24388817-24388839 GATTGTATAAAATTACCTTCAGG - Intergenic
1177866554 21:26519438-26519460 GAGTATGTCAGATTCCCTTCAGG - Intronic
1177870538 21:26567660-26567682 TAATAATTAATATTACCTTCAGG - Intronic
1178336897 21:31751318-31751340 TATTGTATAAAATTTCCTTCAGG + Intergenic
1178830211 21:36050010-36050032 TTTTATGTTAGATGAGCTTCCGG + Intronic
1178988279 21:37328033-37328055 TATTGTATAAAATTACTTTCAGG - Intergenic
1178995501 21:37395483-37395505 TGTCAGGTAAGATTAACTTCTGG - Intronic
1178996645 21:37407259-37407281 TATTGTATAAAATTACCTTCAGG - Intronic
1179264413 21:39790268-39790290 TATTATGTAATATTACATTCTGG + Intronic
1179763765 21:43553766-43553788 TACTATATAAAATTACCTTCGGG + Intronic
1180089462 21:45526353-45526375 TATTATATAAAATCACCTTCTGG - Intronic
1180459041 22:15541904-15541926 TATTGTATAAGATTACCTTCAGG + Intergenic
1180708427 22:17823634-17823656 TATTATATAAAATTATCTTTAGG + Intronic
1182241814 22:28922058-28922080 TACTGTATAAAATTACCTTCAGG - Intronic
1185021299 22:48377910-48377932 TATTACATGAAATTACCTTCAGG - Intergenic
949956973 3:9277081-9277103 TATTATAAAAGATTATCTTGAGG + Intronic
950589758 3:13928565-13928587 TATTTTGAAAGTTTTCCTTCTGG - Intergenic
950916712 3:16653352-16653374 TGTTGTATAAAATTACCTTCTGG - Intronic
950942919 3:16911930-16911952 TATTGTATAAAATTACCTTCAGG + Intronic
951015076 3:17722410-17722432 TATTGTGTAAAATTACCTTAAGG - Intronic
951086956 3:18523399-18523421 TTTTGTGTAAAATTACCTTTAGG + Intergenic
951783708 3:26393824-26393846 TATTATGTATAATTAATTTCTGG + Intergenic
952799908 3:37280400-37280422 TATGATATAAAATTACCTTCAGG + Intronic
952874077 3:37927311-37927333 TATTGTGTAAAATTACCTTCAGG + Intronic
952879979 3:37978484-37978506 TATTGTATAAAATTACCTTTAGG - Intronic
953109098 3:39915717-39915739 TAATAATGAAGATTACCTTCTGG - Intronic
953517281 3:43606998-43607020 TATTATATAAAATTACTTTTAGG + Intronic
953945671 3:47145320-47145342 TATTGTATAAAATTACCTTCAGG - Intronic
954229215 3:49203386-49203408 AATTATCTATGATTACCTACAGG - Intronic
954503770 3:51048537-51048559 TATTATACAAAGTTACCTTCAGG - Intronic
956001012 3:64730076-64730098 TATTGTATAAAATTACCTTCAGG - Intergenic
956685083 3:71819115-71819137 TATAATGTAAGATTTCCTTTGGG - Intergenic
956928432 3:74015259-74015281 TGTTATATAAAATTGCCTTCAGG + Intergenic
957609660 3:82450721-82450743 TATTATATAAAATTACTTTCAGG + Intergenic
958414447 3:93857250-93857272 TATTATATAAATTTACCTTCAGG - Intergenic
958427022 3:93990470-93990492 TATTTTATAAAATTACCTTCAGG - Intronic
958630632 3:96678394-96678416 TATCATATAAAATTATCTTCAGG - Intergenic
959193756 3:103150234-103150256 TATTATATAAAATTACCTTCAGG - Intergenic
959796576 3:110437036-110437058 TATTGTGTTAGAATACCTTAAGG + Intergenic
960697119 3:120406972-120406994 TATTGTATAAAATTACCTTCAGG - Intronic
960911179 3:122650835-122650857 TATAATGAAAGATTAACATCTGG - Intergenic
960999244 3:123361817-123361839 TGTTGTATAAAATTACCTTCAGG - Intronic
961576725 3:127842917-127842939 TATTGTATAAAATCACCTTCAGG + Intergenic
962561455 3:136611133-136611155 AATTATGTAAAATTCCTTTCAGG - Intronic
963369197 3:144376531-144376553 TATTACATAAAATTACCTTCTGG - Intergenic
963390564 3:144658502-144658524 TATTGTATAGAATTACCTTCAGG + Intergenic
963510681 3:146244240-146244262 TATTGTATAAAATTATCTTCAGG + Intronic
963695157 3:148557604-148557626 TATTCTGTAAAATTACCTTCAGG + Intergenic
963714720 3:148789979-148790001 TACTGTGTAAAATTACCTTCAGG - Intergenic
964596128 3:158431140-158431162 AATTATTAAAGATTAGCTTCAGG - Intronic
964727972 3:159834785-159834807 TATTGTATAAAATTACCTTCAGG + Intronic
965477492 3:169175425-169175447 TATTCTATAAAATTACCTTCAGG + Intronic
965762166 3:172090848-172090870 TATTGTATAAAATTATCTTCAGG + Intronic
966384511 3:179381739-179381761 TATTGGATAAAATTACCTTCAGG + Intronic
966435302 3:179876999-179877021 TACTTTATAAAATTACCTTCAGG - Intronic
966755080 3:183361960-183361982 TAGTGTATAAAATTACCTTCAGG + Intronic
966795211 3:183706996-183707018 TGTTGTATAAAATTACCTTCAGG + Intronic
967665630 3:192168456-192168478 TAATATTTAAACTTACCTTCAGG - Intronic
968349509 3:198041428-198041450 TATTGTATAAAATTACCTTCAGG + Intronic
969267823 4:6076820-6076842 TATTATATACAATTCCCTTCAGG - Intronic
970677479 4:18468033-18468055 TATTATTTAAAATTACCAACTGG + Intergenic
970746718 4:19307129-19307151 TATGGTGAAAGCTTACCTTCTGG + Intergenic
971019650 4:22521218-22521240 TATTGTATAAAATTACCTTCAGG + Intergenic
971387329 4:26153075-26153097 TACTGTGTAAAATTACCTTCAGG - Intergenic
971844379 4:31899345-31899367 TACTATATAAATTTACCTTCAGG + Intergenic
971882936 4:32405042-32405064 TTTTATGTAAAATTACTTTTTGG + Intergenic
972665789 4:41164148-41164170 TATTGTGTAAAATTTCCTTTAGG - Intronic
973030785 4:45335296-45335318 TATTGTATAAAATTTCCTTCAGG - Intergenic
973768585 4:54186611-54186633 TATTGTATAAAATTACCTTCAGG + Intronic
973812016 4:54580610-54580632 TATTGTATAAAATTACCTTCAGG - Intergenic
974005235 4:56549768-56549790 TATTATATAAAATTACCTTCAGG + Intronic
974006773 4:56565651-56565673 TATTATATAAAATTACCCTCAGG + Intronic
974209868 4:58757791-58757813 TATGATATAAAATTACCTTTAGG + Intergenic
974429537 4:61778137-61778159 CATTGTATAAAATTACCTTCAGG + Intronic
974437836 4:61879466-61879488 TATTGTATAAAATTACCTTTGGG - Intronic
974486077 4:62507779-62507801 TAGTGTATAAAATTACCTTCTGG - Intergenic
974486198 4:62509366-62509388 TAGTGTATAAAATTACCTTCTGG + Intergenic
974638839 4:64602790-64602812 TATTATATAAAATTAACTCCAGG - Intergenic
974708027 4:65547861-65547883 TTCTATATAAGATTGCCTTCTGG - Intronic
974809284 4:66924877-66924899 TATTATGTCAGAATTCCATCAGG - Intergenic
975235070 4:71984763-71984785 TATTACATAAAATTACCTTTAGG - Intergenic
975270868 4:72431550-72431572 TATTGTACAAAATTACCTTCAGG + Intronic
975576215 4:75865238-75865260 TATTTTATAAAATTACCTTCAGG - Intronic
975685015 4:76911370-76911392 TATTATATAAAATTACTTTTGGG - Intergenic
975834412 4:78407006-78407028 CATTATATAAAATTACCTTCAGG + Intronic
976105119 4:81608378-81608400 TATTATGTAAGTTTATTTGCTGG - Intronic
976187900 4:82460955-82460977 TAATATGTAAGATTTTCCTCTGG + Exonic
976418268 4:84805114-84805136 TATTACATAAAATTATCTTCTGG + Intronic
976418707 4:84811912-84811934 TATTGTATAAAATTACCTTCAGG - Intronic
976748708 4:88432175-88432197 TATTGTTTGAAATTACCTTCAGG + Intronic
976935873 4:90631854-90631876 TATTGTATAAAATTACCTTTGGG + Intronic
977299578 4:95252923-95252945 TATTATATAAAGTTACCTTCAGG + Intronic
977690589 4:99904462-99904484 TATTGTATAAAATTACCTTCAGG + Intronic
978329058 4:107591722-107591744 TATTGCATAAAATTACCTTCAGG - Intronic
978329307 4:107595208-107595230 TATTGGATAAAATTACCTTCAGG + Intronic
978572289 4:110151331-110151353 TATTATATAAAATTACCTTTAGG - Intronic
978867379 4:113530290-113530312 TATTTCATAAAATTACCTTCAGG - Intronic
978882603 4:113724761-113724783 TATTATCTAACGTTACCTTAAGG - Intronic
978922953 4:114207679-114207701 TATTGTATAAAATTACCTCCAGG - Intergenic
979065597 4:116128523-116128545 TATTATATAAAATTACCTTCAGG - Intergenic
979577169 4:122307213-122307235 TATTTTATAAAATTATCTTCAGG - Intronic
979631952 4:122912903-122912925 TATTGTATAAAATTGCCTTCAGG - Intronic
979841191 4:125442602-125442624 TATTAGATAAAATTATCTTCTGG + Intronic
980369432 4:131848414-131848436 TCTTATGTAAGATTAACTTATGG + Intergenic
980941242 4:139277004-139277026 TATTGTATGAAATTACCTTCAGG - Intronic
981726801 4:147856572-147856594 TATTGTATAAAATTACCTTTAGG + Intronic
981775713 4:148364927-148364949 TATTGTGTAAAATTAGCTTCAGG - Intronic
981777481 4:148386401-148386423 TTTTATGAAAAATTACCATCAGG - Intronic
981943529 4:150313864-150313886 TATTATATAAAATTACCTTCAGG - Intronic
982342976 4:154323739-154323761 TATTGTATAAAATTACCTTCAGG + Intronic
982591634 4:157320900-157320922 TATTCTATAAAATTAGCTTCTGG + Intronic
982708918 4:158740082-158740104 TATTGTATAAAATTACCTTCAGG + Intergenic
982714233 4:158790075-158790097 TATTATATACAATTACTTTCCGG + Intronic
982752175 4:159175601-159175623 TATTCTTTAAGATGATCTTCAGG + Intronic
982866107 4:160513824-160513846 TATTATATAAAATTACGTTTGGG + Intergenic
983302320 4:165942513-165942535 TATTCGGTTAGATTACGTTCTGG - Intronic
983796218 4:171867302-171867324 TATTATACAAGATGACCTTTAGG - Intronic
983848946 4:172556028-172556050 CATTATGTTAGGATACCTTCTGG + Intronic
983881019 4:172932728-172932750 TATTGTATAAAATTACCTTCAGG - Intronic
983907132 4:173195606-173195628 TACTTTGAGAGATTACCTTCAGG - Intronic
983953694 4:173672978-173673000 CATTATATAAAATTACTTTCAGG - Intergenic
984315170 4:178120296-178120318 TATTGTATAAAATTACCTTTAGG + Intergenic
984761806 4:183368796-183368818 TATTGTATTAAATTACCTTCGGG + Intergenic
984908756 4:184652578-184652600 TATTATATAAGTTCACTTTCTGG - Intronic
985326698 4:188778673-188778695 TTTTATTTAAGATTACATTTGGG + Intergenic
986505551 5:8446742-8446764 AAATATATAAAATTACCTTCAGG + Intergenic
987062471 5:14255706-14255728 TATTGTATAAAATTACCTTCAGG - Intronic
987522036 5:18999019-18999041 TGTTATGTAAAATGAGCTTCTGG + Intergenic
987639384 5:20592983-20593005 TTTTATATAAAATTACTTTCAGG + Intergenic
987797138 5:22642214-22642236 AATTATGTAAGTTAACATTCTGG + Intronic
988461337 5:31440790-31440812 TATTGTATAAAATTACCTTCAGG + Intronic
988870097 5:35379930-35379952 TAGTATATAAAATTACCTTCAGG - Intergenic
989078680 5:37592224-37592246 TATTATATAAAATTACCTTCAGG - Intronic
989173811 5:38500477-38500499 TATTGTATGAAATTACCTTCAGG - Intronic
989202789 5:38781992-38782014 TTTTATATAAAATTACCTTCAGG + Intergenic
989223285 5:38994205-38994227 TATTATACAAAATTAACTTCAGG + Intronic
989243733 5:39229866-39229888 CATTTTGTAAAATTACCCTCAGG - Intronic
989321520 5:40140319-40140341 TTTTATTTATGATTTCCTTCTGG - Intergenic
989761072 5:45017635-45017657 TCTTATGTTAGATTTGCTTCCGG + Intergenic
989785459 5:45322608-45322630 TATTGTGTAAAATTACCTTCAGG - Intronic
990055282 5:51568958-51568980 TATTTTATAAAATTACTTTCAGG - Intergenic
990110992 5:52324556-52324578 CATCATGAAAAATTACCTTCAGG + Intergenic
990202541 5:53394124-53394146 TATTGTATAAAATTTCCTTCTGG - Intergenic
990730060 5:58798618-58798640 TATTGTATAAAATTACCTTCAGG + Intronic
990784207 5:59401093-59401115 TATTGTGTAAAATTACCTTCAGG + Intronic
991059486 5:62357607-62357629 AATTATGTAATATTTCCTCCAGG - Intronic
991483482 5:67109367-67109389 TATTCTATAAATTTACCTTCAGG + Intronic
992055656 5:72986827-72986849 TATTGTATAAAATTACCTTCAGG - Intronic
992126462 5:73647222-73647244 TATTGTGTACAATTACCTTTAGG + Intronic
992513106 5:77460713-77460735 TATTGTATAAAACTACCTTCAGG - Intronic
992656535 5:78915776-78915798 TATTGTATAAAATTACCTTCAGG - Intronic
993197690 5:84769952-84769974 TATTGTATAAAATTACCTTCAGG - Intergenic
993216598 5:85031622-85031644 TATTGTACAAAATTACCTTCAGG - Intergenic
993216867 5:85035817-85035839 TAATGTGTAAAATCACCTTCAGG - Intergenic
993407314 5:87527401-87527423 TATTTCATAAAATTACCTTCAGG + Intergenic
994877444 5:105443566-105443588 AATTGTATAAAATTACCTTCAGG + Intergenic
995485824 5:112639026-112639048 TATTGTATAAAATTACCTTCAGG - Intergenic
995649253 5:114349437-114349459 TATTGTATAAAATTACCTTCAGG + Intergenic
995810347 5:116100039-116100061 TATTGTGTAAGATTACCTTCAGG - Intronic
995863593 5:116666502-116666524 TATTTTATAAAATTACCCTCAGG - Intergenic
996014522 5:118518294-118518316 TATTGAATAAAATTACCTTCAGG + Intergenic
996034900 5:118747852-118747874 TATTGTATAAAATTACCTTCAGG + Intergenic
996429146 5:123351724-123351746 CGTTATGTAAAATTACTTTCAGG - Intronic
997133116 5:131296906-131296928 TATTATAAAAGATTTCCTTGTGG + Intronic
997759932 5:136435374-136435396 TATTTTACAAAATTACCTTCAGG - Intergenic
998584180 5:143408640-143408662 TATTGTATAAAATTATCTTCAGG - Intronic
998637789 5:143975481-143975503 TATTGTACAAAATTACCTTCAGG + Intergenic
999116309 5:149166826-149166848 TATTATCTATGATTGCTTTCAGG - Intronic
1002135060 5:177102394-177102416 TATTGTATAAAATTACCTTTAGG - Intergenic
1002151429 5:177235258-177235280 TATTTTGTAAAATTACCTTCAGG + Intronic
1002836777 6:871285-871307 TGTTGTATAAGATTACCATCAGG + Intergenic
1002903026 6:1425660-1425682 TATTGTGTAAAATTACCTTCAGG + Intergenic
1002989007 6:2220634-2220656 TGTTGTATAAAATTACCTTCGGG + Intronic
1003122227 6:3327831-3327853 TCTCATATAAAATTACCTTCAGG - Intronic
1003380046 6:5616604-5616626 TATTGTATAAAATTACCTTCAGG - Intronic
1003603463 6:7539919-7539941 TATTGTATAAAATTACCTTCAGG + Intergenic
1003610828 6:7613697-7613719 TATTATATGAAATTGCCTTCAGG + Intergenic
1003697591 6:8426313-8426335 TGTTCTATAAAATTACCTTCAGG - Intronic
1003699149 6:8443054-8443076 TATTGTTTAAAATTACCTTCAGG - Intergenic
1003752997 6:9083093-9083115 CATTGTCTAAAATTACCTTCAGG - Intergenic
1003804939 6:9716998-9717020 TATTATCACAGCTTACCTTCTGG + Intronic
1003881003 6:10479592-10479614 TGTTATATAAAATTACCCTCAGG + Intergenic
1003906373 6:10703631-10703653 TATTGTGTAAAATTACCTTCCGG + Intronic
1004028726 6:11845272-11845294 TATTGTATAAAATTACCTTCAGG - Intergenic
1004072887 6:12318221-12318243 TATTATGTAAAATTACCTTCAGG - Intergenic
1004175500 6:13336394-13336416 TATTATATAAAATTACCTTCAGG + Intergenic
1004364962 6:15004611-15004633 TATTGTATTAAATTACCTTCAGG - Intergenic
1004488847 6:16094479-16094501 TGTTATATAAAACTACCTTCAGG + Intergenic
1004859863 6:19792491-19792513 TATTATATAAAATTACCTTTAGG - Intergenic
1005170200 6:22975495-22975517 TATTATATAAGATTACCTTCAGG + Intergenic
1006011998 6:31050469-31050491 TATCACGTAAAGTTACCTTCAGG + Intergenic
1006263859 6:32899168-32899190 TATGGTATAAAATTACCTTCAGG - Intergenic
1006661931 6:35653963-35653985 TATTGTATAATATTACCTTCAGG + Intronic
1008086522 6:47250955-47250977 TTTTGTATAAAATTACCTTCAGG + Intronic
1008304003 6:49878447-49878469 TATTGTATAAAATTATCTTCAGG - Intergenic
1008461142 6:51773945-51773967 TATTATGAAAGATTGGTTTCAGG - Intronic
1008774158 6:55015576-55015598 TATTATGCTAGATTACAGTCTGG - Intergenic
1009279999 6:61736746-61736768 TATTATGTAAAATGACCTTGAGG - Intronic
1010093773 6:72015157-72015179 TATTGTATAAAATTACCTTCAGG - Intronic
1010778895 6:79920616-79920638 AATTTTATAAAATTACCTTCAGG - Intronic
1011413362 6:87089878-87089900 TAGTATATAAAATTACCTTCAGG + Intronic
1011422979 6:87193735-87193757 CATTATATAAAATTACTTTCAGG + Intronic
1011460403 6:87597207-87597229 TATTATGTAAAATTCGTTTCAGG - Intronic
1012267185 6:97159732-97159754 TATTGTAAAAAATTACCTTCAGG + Intronic
1012506691 6:99954862-99954884 TATTACATAAAATTACTTTCAGG + Intronic
1012846085 6:104391031-104391053 TATTGTATAAAATTACCTTCAGG + Intergenic
1013223314 6:108099558-108099580 TATTGTGTAAAATTGCCTTCCGG + Intronic
1013391027 6:109686623-109686645 TGGTATGTAAGGATACCTTCTGG + Intronic
1013531130 6:111019753-111019775 AATTGTATAAAATTACCTTCAGG + Intronic
1013575144 6:111476107-111476129 AATTATATAAAATTACATTCAGG - Intronic
1014190712 6:118493700-118493722 TAATACGGAAGATTATCTTCTGG + Intronic
1014624014 6:123703928-123703950 TATTACATAAAATTACCTTTAGG + Intergenic
1014766605 6:125414226-125414248 TATTGTATAAAATTACCTTCAGG + Intergenic
1014978093 6:127914096-127914118 TATTGTATAAAATTACATTCAGG - Intronic
1015113576 6:129620212-129620234 TATTTTGTAAAATTGCCTTCAGG - Intronic
1015143687 6:129962314-129962336 TATTGTATAAAATTACCTTCAGG + Intergenic
1015219584 6:130788920-130788942 TATTGTCTAAGATAATCTTCTGG - Intergenic
1015824031 6:137293051-137293073 TATTATATAACATCACCTTTAGG - Intergenic
1016149602 6:140723202-140723224 TATTGTATAAAATTACCTTTAGG - Intergenic
1016336931 6:143016568-143016590 TTTTACATAAAATTACCTTCAGG - Intergenic
1016358340 6:143241871-143241893 TATCATGTAAAGTTACCTTCAGG + Intronic
1016501119 6:144721808-144721830 TATTGTATAAAATTACCTTCAGG - Intronic
1016603396 6:145889588-145889610 TATTATATAAAATCACCTTCAGG + Intronic
1016671208 6:146710749-146710771 TATTTTTTATGATTATCTTCTGG - Intronic
1016926780 6:149358293-149358315 TACTGTATAAAATTACCTTCAGG - Intronic
1016975244 6:149801252-149801274 TATTATACAAAATTACCTTCAGG - Intronic
1017543261 6:155424636-155424658 TATTAATTAAGATTAACTTGAGG - Intronic
1017749174 6:157473783-157473805 TATTGTGTAAAATTACTTTCAGG + Intronic
1018100738 6:160437205-160437227 TGTGGGGTAAGATTACCTTCTGG - Exonic
1018530190 6:164754827-164754849 TATTATATAAAATTACTTTCAGG + Intergenic
1018559796 6:165089862-165089884 TAATGTATAAAATTACCTTCAGG + Intergenic
1020346150 7:7165884-7165906 TATTGTATAAAATTACCATCAGG + Intronic
1020908848 7:14102678-14102700 TGTTATATAAAATTACCTTCAGG - Intergenic
1021239678 7:18184498-18184520 TATTGAATAAAATTACCTTCAGG - Intronic
1021271187 7:18588488-18588510 TATTGTATAAAATTACCTTCAGG - Intronic
1021549815 7:21859047-21859069 TATTGTATAAAATTAACTTCAGG + Intronic
1021971572 7:25970295-25970317 TACTATATAAAATTACCTTCAGG + Intergenic
1022642338 7:32199940-32199962 TACTGTGTAATGTTACCTTCAGG + Intronic
1023481407 7:40638745-40638767 TGTGATGTCAGATTGCCTTCTGG + Intronic
1024162883 7:46696915-46696937 TATTATGTTAGAATTCTTTCTGG + Intronic
1025031838 7:55563649-55563671 TATTGTATAAAATTACCTTCAGG - Intronic
1026131445 7:67624296-67624318 TATTGTATAAAATTACCTTCAGG - Intergenic
1027289658 7:76691948-76691970 TATTGTATAAAATTACCTTCAGG - Intergenic
1027369225 7:77490876-77490898 TATTGTGTAAAATTACCTTCAGG + Intergenic
1027400578 7:77801653-77801675 TGTTATATAAAATTACCTTTGGG + Intronic
1027481236 7:78699435-78699457 TATTGTATGAAATTACCTTCAGG + Intronic
1027499777 7:78934621-78934643 TATCGTATAAAATTACCTTCAGG + Intronic
1027956940 7:84891558-84891580 TATTGTATAAAATTACCTTCAGG + Intergenic
1028204530 7:88001307-88001329 GATTGTATAAAATTACCTTCAGG - Intronic
1028282159 7:88944876-88944898 TATTGTATAAAATTACCTTTGGG + Intronic
1028430582 7:90743015-90743037 TATTGTATAAAATTACATTCAGG - Intronic
1028614170 7:92746490-92746512 TATTGTATAAAATTACCTTCAGG + Intronic
1028741705 7:94282867-94282889 TATTACATAAGATTACTTCCAGG + Intergenic
1028937014 7:96476621-96476643 TATTGTACAAAATTACCTTCCGG + Intergenic
1029067385 7:97864980-97865002 TATTATATAAAATTACCTTTAGG - Intronic
1030031615 7:105375015-105375037 TATTTTGTTATATTTCCTTCTGG - Intronic
1030153848 7:106432073-106432095 TATTATATAAAATTACCTTCAGG - Intergenic
1030489998 7:110220478-110220500 TATTATGTAGGAACACCATCTGG - Intergenic
1030616817 7:111745945-111745967 TATTATATAAAATGACCTTCAGG + Intronic
1030710362 7:112741860-112741882 TCTTATATAAAATTATCTTCAGG - Intergenic
1030883717 7:114913684-114913706 TATTATATAAAATTCTCTTCAGG - Intergenic
1031058243 7:117018277-117018299 TCTTATGTAAGATAATATTCTGG + Intronic
1031131440 7:117837657-117837679 TATGATATAAAATTACCTCCAGG - Intronic
1031288695 7:119905873-119905895 TTTTATGTAAAATAACCTTGAGG + Intergenic
1031695940 7:124854264-124854286 TATTATAGAAAATTACTTTCAGG - Intronic
1031778456 7:125932355-125932377 TATTGTGTAAGATTACATTGAGG - Intergenic
1032350911 7:131162556-131162578 TATTATATAAAATTACCTTCAGG + Intronic
1032630633 7:133647270-133647292 AATTATGTAAGGGTACATTCTGG + Intronic
1032635385 7:133701816-133701838 TATTATACAAAGTTACCTTCAGG - Intronic
1033012928 7:137641528-137641550 TATTGTATAAAATTACCTTCAGG + Intronic
1033073850 7:138230160-138230182 TATTGTATAAAATTTCCTTCAGG - Intergenic
1033674466 7:143525929-143525951 TATTATTTAACATTACATGCAGG - Intergenic
1033856631 7:145569556-145569578 TATTGTATAAAATTACCTTCAGG - Intergenic
1033936398 7:146591136-146591158 TGTTACATAAAATTACCTTCAGG + Intronic
1034606281 7:152319090-152319112 TATTCTATAAAATTACCTTCAGG + Intronic
1034912122 7:155005298-155005320 TATAATATAACCTTACCTTCAGG + Intergenic
1035359090 7:158298510-158298532 AATTACATAACATTACCTTCAGG - Intronic
1035542038 8:447725-447747 TACTGTATAAAATTACCTTCAGG - Intronic
1035849594 8:2902712-2902734 TAATCTGTAAGAATACTTTCAGG - Intergenic
1036435712 8:8731143-8731165 TAATGTATAAAATTACCTTCAGG - Intergenic
1037533203 8:19799693-19799715 TAGTATGTAAGATTACCTTTAGG - Intergenic
1037655892 8:20883835-20883857 TATTCTGTAAGATGTCCTCCCGG + Intergenic
1038079758 8:24120585-24120607 TATTCTATAAAATTACCTTCAGG + Intergenic
1038350116 8:26768619-26768641 TATTGTATAAAATTACCCTCAGG + Intronic
1038519022 8:28213475-28213497 TATTGTATAAAATTACCTTCAGG - Intergenic
1038766692 8:30435209-30435231 TATTATATAAAATTACCTTTGGG + Intronic
1038830026 8:31046969-31046991 TACTATGTAAGATTTGCTTTAGG + Intronic
1038886538 8:31669030-31669052 TATTATGTAAAATTACCTTCAGG - Intronic
1039015179 8:33139932-33139954 TATTGTATAAAATTACTTTCAGG - Intergenic
1039374317 8:37018096-37018118 TATTATATAAAATTACCTTCAGG + Intergenic
1039865327 8:41496115-41496137 TATTGTATAAAATTACCTTCAGG - Intronic
1039973541 8:42340375-42340397 GACTATATAAGATTACCTTCAGG + Intronic
1040354240 8:46601191-46601213 TATTATATAAAATTACCTTTAGG - Intergenic
1040892818 8:52335563-52335585 TATTGTGTAAGATCACCTTCAGG - Intronic
1041183855 8:55277536-55277558 TATTATATAAAATTAACTTCAGG - Intronic
1041725771 8:61016120-61016142 TATTGTATAAAATTACCTTCAGG + Intergenic
1042314766 8:67413894-67413916 TATTGTATAGGATTACCTTCAGG - Intergenic
1042559536 8:70062768-70062790 TATTGTGTAAAATTACCTTCAGG - Intronic
1042741058 8:72047692-72047714 TATTATATAAAATTACCTTCAGG + Intronic
1042974265 8:74447822-74447844 TATTATATAAAATGACCTTTAGG + Intronic
1043422491 8:80112975-80112997 TAGTGTATAAGTTTACCTTCAGG - Intronic
1043607907 8:82025065-82025087 TATGCTGTAAGAAGACCTTCTGG - Intergenic
1043850220 8:85207809-85207831 TATTGTATAAAATTATCTTCAGG + Intronic
1043967280 8:86493776-86493798 TCTTGTATAAAATTACCTTCAGG + Intronic
1044125611 8:88455608-88455630 TATTGTATAAGATTACCTTTAGG + Intergenic
1044148832 8:88747739-88747761 TATTGTATAAAATTACCTTCAGG - Intergenic
1044195372 8:89370799-89370821 TGTTGTATAAAATTACCTTCAGG - Intergenic
1044641850 8:94390887-94390909 TACTGTATAAAATTACCTTCAGG - Intronic
1045030075 8:98126764-98126786 TATTGTATAAAATTACCTTCAGG + Intronic
1045094152 8:98779535-98779557 TATTGTATAACATTACCTACAGG + Intronic
1045262367 8:100587733-100587755 TATCATATAAAATTACCTTCAGG + Intronic
1045823788 8:106372650-106372672 TATTATATAAAATTATCTCCAGG + Intronic
1046412457 8:113864151-113864173 TATCGTGTAAAATAACCTTCAGG - Intergenic
1046814474 8:118569280-118569302 TATTGTATAAAATTGCCTTCAGG + Intronic
1047427117 8:124756669-124756691 TATTGTATAAATTTACCTTCAGG - Intergenic
1047467133 8:125127874-125127896 TGTTGTATAAAATTACCTTCAGG - Intronic
1047475238 8:125221729-125221751 CATTGTATAAAATTACCTTCAGG - Intronic
1047611346 8:126523746-126523768 TATTATGTAAGATTTGATTTAGG + Intergenic
1047999817 8:130369304-130369326 TATAGTATAAGATTACCTTCAGG - Intronic
1048238743 8:132719400-132719422 TATTGTGTAAAGTTACCTTTAGG + Intronic
1049071967 8:140362810-140362832 TCTTATGTGAGAAAACCTTCTGG - Intronic
1049809648 8:144559826-144559848 TATTCTATAAAATTGCCTTCAGG - Intronic
1049912569 9:283776-283798 TATTGTTTAAAATTACCTTCAGG + Intronic
1050152005 9:2626276-2626298 TAGTCTATAAAATTACCTTCAGG - Intronic
1050673917 9:8030022-8030044 TAGTCTTTAAGATTACTTTCAGG + Intergenic
1050941575 9:11466809-11466831 TTTTATGAAATAATACCTTCAGG + Intergenic
1051447680 9:17157950-17157972 TATTAATTAAAACTACCTTCAGG + Intronic
1051784569 9:20728362-20728384 TATTGTACAAAATTACCTTCAGG - Intronic
1051806059 9:20993578-20993600 TATTATATAAAATTACCTTCCGG - Intronic
1053192991 9:36089657-36089679 TACTGTATAAGATTACCTTCAGG + Intronic
1053633811 9:39974082-39974104 TCTTATGTAAGATTAACTTATGG + Intergenic
1053771936 9:41489418-41489440 TCTTATGTAAGATTAACTTATGG - Intergenic
1054210076 9:62276615-62276637 TCTTATGTAAGATTAACTTATGG - Intergenic
1054314918 9:63572311-63572333 TCTTATGTAAGATTAACTTATGG + Intergenic
1054355669 9:64059624-64059646 TATTATATAAAATTACTTTTAGG + Intergenic
1054963824 9:70999408-70999430 TATTATTTCAGATCACGTTCAGG - Intronic
1055063435 9:72093935-72093957 TATTGCATAAAATTACCTTCAGG + Intergenic
1055115612 9:72602005-72602027 TATTATATAAAATTACCTTCAGG - Intronic
1055311317 9:74984596-74984618 TATTGTATCAAATTACCTTCGGG + Intronic
1055523481 9:77106505-77106527 TATTGTACAAAATTACCTTCAGG - Intergenic
1055876620 9:80950834-80950856 AATTGTATAAAATTACCTTCAGG + Intergenic
1056143079 9:83703400-83703422 TATTGTATAAAATTACCTTTAGG + Intronic
1056648765 9:88439423-88439445 TATTACATAAAATTACTTTCAGG + Intronic
1057424812 9:94939704-94939726 TAATGTATAAAATTACCTTCAGG + Intronic
1058363159 9:104174739-104174761 GATTGTATAAAATTACCTTCAGG + Intergenic
1058366159 9:104211084-104211106 CATTGTATAAAATTACCTTCAGG + Intergenic
1058725571 9:107800331-107800353 TATCATATAAAATTACCTTAAGG - Intergenic
1058832236 9:108829322-108829344 TATTGTATAAGATTACCTTCAGG - Intergenic
1060464679 9:123892705-123892727 TATTATTTTATTTTACCTTCTGG - Intronic
1060611787 9:124973134-124973156 TATTATGTAAAGTTACCTTTAGG - Intronic
1060652547 9:125341258-125341280 TATTTTATAAAATTACCTTTAGG - Exonic
1203744009 Un_GL000218v1:28754-28776 TATTATATAAAATTACCTTTAGG + Intergenic
1203566105 Un_KI270744v1:90787-90809 TATTATATAAAATTACCTTTAGG - Intergenic
1186484916 X:9926756-9926778 TATTGTATAAAATTACCTTCAGG + Intronic
1187170774 X:16849377-16849399 TATGTTTTAAGATTACTTTCTGG - Intronic
1187183900 X:16966514-16966536 TATTGTATAAAATTACCTTTAGG - Intronic
1187891214 X:23936595-23936617 TAATATGTAAGAGGACCTACTGG + Intronic
1187919116 X:24183674-24183696 AATTGTATAAAATTACCTTCAGG + Intronic
1188059211 X:25580023-25580045 TATTTTATAAAATTACCTTCAGG + Intergenic
1188228759 X:27634770-27634792 TATTGCATAAAATTACCTTCAGG + Intronic
1188251073 X:27895469-27895491 TATTGTATAAAATTACATTCAGG - Intergenic
1188550763 X:31362404-31362426 TATTGTATAAAATTTCCTTCAGG + Intronic
1188939587 X:36220191-36220213 TGTCATGTAAAATTACCTTCAGG + Intergenic
1189299030 X:39938948-39938970 TATTGTATAAAATTACCTTCAGG + Intergenic
1190140532 X:47839508-47839530 TGTTATATAAAATTACCTTCAGG + Intronic
1190765117 X:53469681-53469703 TATTGTATAAAATTACCTTCAGG + Intergenic
1190788156 X:53673450-53673472 AATTGTGTAAAATTACCTTCAGG - Intronic
1193373712 X:80732080-80732102 TATTGTATAAAATTACTTTCAGG + Intronic
1193775025 X:85630815-85630837 TATTTTGTAAGATTGCTTTTAGG + Intergenic
1194038006 X:88902845-88902867 TATTGTATAAAATTACCTTCAGG - Intergenic
1194464591 X:94217881-94217903 TATTATATAAAATTACCTTCAGG + Intergenic
1194860869 X:98997862-98997884 TATTATGCAAAGTTATCTTCAGG - Intergenic
1195158957 X:102152945-102152967 TATTGTATAAAATTACCTTCAGG + Intergenic
1195607015 X:106817516-106817538 TATTGTATAAAATTATCTTCGGG + Intronic
1195624345 X:106992012-106992034 TAATATATAATATTAACTTCAGG + Intronic
1195955876 X:110329824-110329846 TATTGTATAAAATTACCTTCAGG + Intronic
1196106100 X:111897058-111897080 TATTCTATAAAATTACATTCAGG + Intronic
1196291017 X:113941190-113941212 TATTGTATAAAATTACCTTCAGG - Intergenic
1196985318 X:121263664-121263686 TATTCTATAAAATTACCTTCAGG - Intergenic
1198001154 X:132438178-132438200 TATTGTATAACATTACCTTCAGG + Intronic
1199198769 X:145062871-145062893 TATTGTCTAAAATTATCTTCAGG - Intergenic
1199380292 X:147164541-147164563 TATTTTCTAAGATTTTCTTCAGG + Intergenic
1201157326 Y:11143733-11143755 TATTATATAAAATTACCTTTGGG + Intergenic
1202247708 Y:22836642-22836664 TAATATGTCAAAATACCTTCTGG - Intergenic
1202400696 Y:24470390-24470412 TAATATGTCAAAATACCTTCTGG - Intergenic
1202470084 Y:25199696-25199718 TAATATGTCAAAATACCTTCTGG + Intergenic