ID: 1094333349

View in Genome Browser
Species Human (GRCh38)
Location 12:29320593-29320615
Sequence GATTTGTAGTTAACCAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094333349_1094333352 22 Left 1094333349 12:29320593-29320615 CCAAGACTGGTTAACTACAAATC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1094333352 12:29320638-29320660 GACTTGTAGCTAAAAGACCTAGG 0: 1
1: 0
2: 0
3: 15
4: 148
1094333349_1094333350 -9 Left 1094333349 12:29320593-29320615 CCAAGACTGGTTAACTACAAATC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1094333350 12:29320607-29320629 CTACAAATCAAGTGCTTTACAGG 0: 1
1: 0
2: 0
3: 6
4: 103
1094333349_1094333354 27 Left 1094333349 12:29320593-29320615 CCAAGACTGGTTAACTACAAATC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1094333354 12:29320643-29320665 GTAGCTAAAAGACCTAGGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1094333349_1094333355 28 Left 1094333349 12:29320593-29320615 CCAAGACTGGTTAACTACAAATC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1094333355 12:29320644-29320666 TAGCTAAAAGACCTAGGTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 83
1094333349_1094333353 26 Left 1094333349 12:29320593-29320615 CCAAGACTGGTTAACTACAAATC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094333349 Original CRISPR GATTTGTAGTTAACCAGTCT TGG (reversed) Intronic
904656403 1:32051463-32051485 GCTTTGTAGTCACCCATTCTTGG - Intronic
906259602 1:44376981-44377003 AATTTGAACTTAAGCAGTCTAGG - Intergenic
913196898 1:116464585-116464607 GATTTGGAGTTAAGCAGGTTTGG - Intergenic
918889137 1:190241411-190241433 GCTTTATAGTTAACAAGTTTTGG + Intronic
924601902 1:245498312-245498334 GATGTGAAGTTTATCAGTCTTGG + Intronic
924753212 1:246916819-246916841 GTTTTGGAGTTAAACAGGCTTGG - Intronic
924852805 1:247847592-247847614 GATATATAATTAACCAGTCATGG - Intergenic
1062928206 10:1333893-1333915 GGTTTGTATTTCATCAGTCTGGG - Intronic
1065673291 10:28145645-28145667 AGTTTGTAGTTAGCTAGTCTTGG - Intronic
1068097899 10:52515100-52515122 GATATATAGGTAAGCAGTCTAGG + Intergenic
1068202582 10:53801408-53801430 GATTTGTTGTGAAACAGGCTAGG - Intergenic
1070008162 10:72445692-72445714 GATTTGCAGTTAGGCAGACTTGG + Intronic
1072866340 10:99066464-99066486 GAGTTGGAGTTACCCAGTCTCGG - Intronic
1074712710 10:116190644-116190666 GATTGGTAGATCACGAGTCTGGG - Intronic
1075850578 10:125583262-125583284 GCTTTTAAGTTACCCAGTCTCGG - Intronic
1076775988 10:132698592-132698614 GCTGTGTAGTTAACCTGTCGAGG + Intronic
1079860145 11:25659040-25659062 CATTTGTAGGTCACAAGTCTAGG - Intergenic
1080016436 11:27511567-27511589 AATATGTAGTTCACCAGTGTGGG + Intergenic
1083063723 11:59901035-59901057 GATTTTTAGTTTAACAGTTTTGG - Intergenic
1086058385 11:82675075-82675097 GCTTTGGAGTTACCCAGGCTGGG - Intergenic
1086269020 11:85037274-85037296 GCTTTGTAGTTAGGCAGACTTGG + Intronic
1087015351 11:93549296-93549318 ACTTTGTATTTAACCAGGCTTGG - Intergenic
1087108265 11:94433766-94433788 GTTTTGTAATTGCCCAGTCTCGG + Intronic
1087515143 11:99150461-99150483 TATTTGTAGTTCATAAGTCTTGG - Intronic
1087835119 11:102865778-102865800 TCTTTGTAGATAACCAGTATTGG - Exonic
1088350173 11:108877859-108877881 CATTTGAAGTGAAACAGTCTAGG + Intronic
1088946661 11:114520272-114520294 GAATGGTAGTTATCCAGGCTGGG - Intergenic
1094166527 12:27449133-27449155 GATTTATAATTCAACAGTCTTGG - Intergenic
1094333349 12:29320593-29320615 GATTTGTAGTTAACCAGTCTTGG - Intronic
1097623721 12:61973797-61973819 GATTACAATTTAACCAGTCTTGG - Intronic
1098417423 12:70251329-70251351 GATTTGTAGTTAACTAGGTGGGG + Intronic
1098971027 12:76857210-76857232 GAGAGGTAGTTAAGCAGTCTAGG - Intergenic
1107963259 13:45577254-45577276 GATTTGTTTTTAATCAGTCCAGG - Intronic
1111294339 13:86259385-86259407 TATTTGTAGTGAACCATTCTTGG - Intergenic
1112801332 13:103113081-103113103 GATTTGAAGTTATCTAGGCTGGG + Intergenic
1115176259 14:30564486-30564508 AATTTTTAATTAGCCAGTCTTGG - Intronic
1117033493 14:51702012-51702034 AATTTGTATTTAAGAAGTCTTGG + Intronic
1117406961 14:55413035-55413057 GATTTGTATTTAAAAAGACTGGG - Intergenic
1119990913 14:79196265-79196287 CATTTTGAGTTACCCAGTCTGGG - Intronic
1121736792 14:96224327-96224349 GATTTGAACATAAGCAGTCTGGG - Intronic
1124351893 15:28961796-28961818 GGTTTGGATTTAATCAGTCTCGG + Intronic
1126545238 15:49865830-49865852 GCTTTGTAGTTAGTCAGTCAGGG - Intronic
1130369973 15:83277020-83277042 GATTTGTGGTTTGCCAGACTGGG - Intronic
1133583891 16:7172922-7172944 GTTTTGTAGTTAACTGCTCTAGG - Intronic
1135124406 16:19796353-19796375 TATTTGTAGTGAACCATTCTTGG + Intronic
1135682812 16:24472834-24472856 GATTCCTAGTTAACAATTCTCGG + Intergenic
1137512959 16:49117285-49117307 GATTTGAAGTTAAGCAGGCCTGG + Intergenic
1146217666 17:30991205-30991227 GATGTGAAATTAGCCAGTCTTGG + Intronic
1149056394 17:52371624-52371646 TCTTTGAAATTAACCAGTCTTGG + Intergenic
1149438971 17:56659144-56659166 CATTTGCAGTTAACAAATCTTGG + Intergenic
1150851165 17:68704947-68704969 GATGTGCAGTTACCCAGTATTGG + Intergenic
1151464073 17:74273277-74273299 GATTAGTAGGTAGCCAATCTGGG + Intergenic
1153446507 18:5178779-5178801 GATTTTTATTTTACCAGCCTGGG + Intronic
1153952906 18:10071871-10071893 GCTTTGGAGTCAACCAGGCTGGG + Intergenic
1156007878 18:32465002-32465024 GATTTGTAGTTTTCCCGTGTAGG - Intronic
1156886003 18:42137056-42137078 GATTTGTTGTAAAACACTCTAGG - Intergenic
1158297886 18:56019234-56019256 TATATGTCATTAACCAGTCTGGG + Intergenic
1160521348 18:79509935-79509957 CATTTAAAGTTAACCACTCTTGG + Intronic
1162631009 19:11926702-11926724 TATTTTTAGTTTACCAGTTTAGG + Intronic
1165507467 19:36243332-36243354 GATTTGAAATTATCCAGTTTGGG - Intronic
927085732 2:19672603-19672625 GGTGTGTAGTTAGCCATTCTTGG - Intergenic
930773073 2:55147237-55147259 GATTAGCAGTGAACTAGTCTAGG - Intergenic
931385987 2:61797771-61797793 CTTTTGTAATTACCCAGTCTTGG + Intergenic
931532109 2:63227614-63227636 GATTTGTAGTCAAACAGGCATGG + Intronic
937803505 2:126108851-126108873 GATTTTCTGCTAACCAGTCTAGG - Intergenic
938249820 2:129805987-129806009 GATTAGTAGGTAACCCGGCTGGG - Intergenic
938731085 2:134148343-134148365 GATCTGCAGTTAATTAGTCTGGG - Intronic
940480615 2:154225942-154225964 GATCTGTAGTTAAACAATGTAGG + Intronic
943780645 2:191819877-191819899 GATTTATTGTTAACCAGCCTTGG + Intergenic
943813811 2:192225384-192225406 GATTTGTATTCAAACACTCTTGG - Intergenic
943987822 2:194645254-194645276 AATTTGTAGTGAGCAAGTCTGGG - Intergenic
944281932 2:197907853-197907875 GATTTGTATTTAATTGGTCTGGG + Intronic
948554909 2:238802341-238802363 GGTTTCTAGTTATCCTGTCTAGG - Intergenic
1175424889 20:58856939-58856961 GATTTGAAGTTAAGAAGTCTTGG - Intronic
1176922984 21:14711201-14711223 TATTTGTGCTTAACCATTCTAGG + Intergenic
1183010261 22:34940608-34940630 GATCTGTGCTTAACCTGTCTAGG + Intergenic
1183945212 22:41321792-41321814 GTTTTGTGGTCAACCAGGCTTGG - Intronic
1184830937 22:46986676-46986698 GATTTGTAGTAAATCAATTTTGG + Intronic
955022375 3:55133553-55133575 GATTCGTACTTAACCATTTTAGG + Intergenic
958796799 3:98714493-98714515 GATTTGTCATTTCCCAGTCTAGG - Intergenic
959351662 3:105272527-105272549 TATTTGTAATTACCAAGTCTGGG + Intergenic
960176572 3:114524637-114524659 GATATGTAGCTATCTAGTCTAGG - Intronic
962099606 3:132328077-132328099 GATTTTTATTTAATTAGTCTGGG - Intronic
963689987 3:148487360-148487382 GATATGTGGTTAAACATTCTAGG + Intergenic
963990505 3:151647922-151647944 GTTTTTTAATTAACCAGGCTTGG + Intergenic
965600394 3:170448431-170448453 CTTTTGAAGTTAACCAGTTTTGG + Intronic
967540560 3:190662530-190662552 GATTTGTGCTTAATAAGTCTTGG + Intergenic
974593697 4:63988857-63988879 GATTATTAATTACCCAGTCTCGG + Intergenic
975226020 4:71873169-71873191 GCTTTGTACTTAACAAGTCGAGG - Intergenic
976162878 4:82221766-82221788 TCTTTCTAGTTACCCAGTCTTGG + Intergenic
976312857 4:83629656-83629678 GATTTGTAGTCAGAAAGTCTGGG + Intergenic
979575737 4:122290266-122290288 GATTTCTAGTCAACCATTTTTGG - Intronic
991578638 5:68131192-68131214 GAATAAGAGTTAACCAGTCTGGG - Intergenic
993513463 5:88800209-88800231 GATATGGAGGTAACCTGTCTGGG + Intronic
995100055 5:108289669-108289691 GCTTTGAAGTTAGGCAGTCTGGG + Intronic
995101122 5:108307248-108307270 GACCTTTAGTTATCCAGTCTAGG + Intronic
996098311 5:119421930-119421952 CCTTTGTAATTACCCAGTCTTGG + Intergenic
996467535 5:123821036-123821058 GAGTTGTATTTAACCAGGATGGG - Intergenic
997040247 5:130244272-130244294 GCTCTGGAGTTAACCTGTCTGGG + Intergenic
1003151190 6:3550589-3550611 GTTTTTTAATTAGCCAGTCTTGG - Intergenic
1011636824 6:89382418-89382440 TATATGTAATTAACCAGACTTGG + Intronic
1012361579 6:98389100-98389122 GATTTCTACTTTACCAGTGTTGG + Intergenic
1013074632 6:106760565-106760587 GATTTGTAATCAACCATTATTGG - Intergenic
1015646790 6:135400116-135400138 AATTTGCAGTTATCCAGTTTTGG + Intronic
1022731398 7:33029865-33029887 GATTTAAAGTAAACCAGTATTGG - Intronic
1022801763 7:33783432-33783454 AATCTGTAGTTAACCAATGTGGG - Intergenic
1023170892 7:37389387-37389409 GATTTTTTGTTAAGCAGTCTTGG + Intronic
1024299408 7:47875498-47875520 GATTTTTATTTAACCAGCCTGGG + Intronic
1032601158 7:133296881-133296903 GACTTTTATTTAACCGGTCTGGG - Intronic
1034515648 7:151576357-151576379 GTTTTGTAGGTAAGCAGTGTGGG - Exonic
1035832789 8:2715584-2715606 GCTTTATAATTACCCAGTCTCGG - Intergenic
1037732035 8:21534229-21534251 TATTTGTAGCCACCCAGTCTAGG - Intergenic
1042403262 8:68373804-68373826 GATATGTAGTTACCAAGTCTTGG - Intronic
1043724648 8:83595169-83595191 GATTTGTAATTAAACAGGCTAGG + Intergenic
1046699598 8:117385178-117385200 GATTTGTAGTCACCAAGCCTAGG + Intergenic
1050786477 9:9409714-9409736 GATTTGAAAGTAACCAGTCCTGG - Intronic
1051941929 9:22517281-22517303 GATTTCTACTTGACCAGTCAAGG + Intergenic
1058939606 9:109801012-109801034 CAGTTGTAATTAACCAGACTGGG - Intronic
1186717523 X:12268163-12268185 GATTTTTAATTGACCAGGCTTGG + Intronic
1188651769 X:32639512-32639534 GTTTTGTAATTGACCAGTATCGG + Intronic
1188852969 X:35154463-35154485 TATTTGTAGTTGCACAGTCTGGG + Intergenic
1194255245 X:91626948-91626970 GGCTTGTATTTAACCTGTCTTGG + Intergenic
1194645636 X:96455183-96455205 GATATGTATTTATCCAGTGTGGG - Intergenic
1199236427 X:145499304-145499326 GATTTGTAGTTAGACAGTACGGG + Intergenic
1199688712 X:150289913-150289935 GCTTTGAGGTTAACCAGTCCTGG + Intergenic
1199934280 X:152555975-152555997 GATTTGAAGTTGAGCAGGCTGGG + Intergenic