ID: 1094333353

View in Genome Browser
Species Human (GRCh38)
Location 12:29320642-29320664
Sequence TGTAGCTAAAAGACCTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094333349_1094333353 26 Left 1094333349 12:29320593-29320615 CCAAGACTGGTTAACTACAAATC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094333353 Original CRISPR TGTAGCTAAAAGACCTAGGT TGG Intronic
900271556 1:1792395-1792417 TGTAGTTAAAATATCTATGTTGG + Intronic
903463471 1:23535422-23535444 TGTATGTAAAATACCTAGCTGGG - Intergenic
906843720 1:49167506-49167528 TAGAGCTCAAAGACCTAGGCAGG - Intronic
910603745 1:89059883-89059905 TGTATGGAAAAGACCTATGTTGG - Intronic
910637085 1:89420610-89420632 TGTATGGAAAAGACCTATGTTGG + Intergenic
915394317 1:155571023-155571045 TATAGCTACAAGACTGAGGTTGG + Intergenic
915682434 1:157594742-157594764 TGTAACTAAAAGATCTATTTGGG - Intronic
1072031925 10:91529589-91529611 TTTAGGTAGAAGACCTGGGTGGG - Intergenic
1077943155 11:6865880-6865902 TGGATATAAAAGACCAAGGTGGG - Intergenic
1078085204 11:8229740-8229762 TGGAGCTTCAAGACCTGGGTTGG - Intronic
1080333479 11:31169854-31169876 TGTCTCTCCAAGACCTAGGTTGG - Intronic
1083601701 11:63952650-63952672 GGCAGCTCATAGACCTAGGTAGG - Intronic
1085213894 11:74810393-74810415 TGGACCTGAAAGACCTATGTTGG + Intronic
1086600172 11:88623824-88623846 AGTAGCTAGAAGACCAAGTTTGG - Intronic
1087017057 11:93564190-93564212 CATATCTAAAACACCTAGGTAGG + Intergenic
1088064432 11:105698794-105698816 TGTGGCTGAAAGACCTATTTAGG + Intronic
1094246166 12:28296570-28296592 TGTATCTAAGACATCTAGGTTGG - Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1096859077 12:54510130-54510152 TGTAGCTAAAAAATCATGGTTGG + Intronic
1099370550 12:81824773-81824795 GCTACTTAAAAGACCTAGGTTGG + Intergenic
1102207874 12:111102821-111102843 TGTAGCTAAAACATTTAGCTTGG + Intronic
1105549750 13:21381990-21382012 TCTAGCTAAAAGATCCAGGGAGG + Intronic
1105848831 13:24316697-24316719 TGCATCTATATGACCTAGGTTGG + Intronic
1106341403 13:28831326-28831348 TGTAGTCAAAAGGCATAGGTTGG + Intronic
1109458654 13:62626348-62626370 TGTGTCTAAAAGACCGAGGGGGG + Intergenic
1112767221 13:102758361-102758383 TGAAGCTAAATGAAATAGGTTGG - Intronic
1116122887 14:40743079-40743101 AGGAGCTAGAAAACCTAGGTAGG + Intergenic
1117523466 14:56574601-56574623 TCTAGCTAAAAGACCAAGAAAGG + Intronic
1122964773 14:105117600-105117622 TGCAGATAACAGACCTTGGTGGG - Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1141959431 16:87394569-87394591 TGTAGCTAAAGAAACTGGGTGGG + Intronic
1145918150 17:28588980-28589002 AGTAGCTAAAAGACCACTGTTGG - Intronic
1149490007 17:57077829-57077851 TGTAGTTAAAGGACCTAAATTGG + Intergenic
1149771081 17:59321515-59321537 CGTAGCTAAAAGAGCTAATTTGG + Intergenic
1155381932 18:25232244-25232266 TGCAGGTGAAATACCTAGGTAGG - Intronic
1155679839 18:28475541-28475563 TCTAGCCAAAGGACCTAGATAGG + Intergenic
1157745510 18:50131657-50131679 TGTAGCTCAAAAACCTATGGGGG + Intronic
1159402632 18:67957410-67957432 GGTAGATAAAAGACGCAGGTGGG - Intergenic
1159484539 18:69037882-69037904 TTTACCTCAAAGACCTAGGTGGG - Intronic
1162495258 19:11019837-11019859 TGTAGGGGAAAGGCCTAGGTGGG + Intronic
1166425196 19:42671140-42671162 TTTAGCTAGATGACCTAGGGAGG + Intronic
1168034854 19:53711240-53711262 TGAATCCAAAAGACCTAGGTTGG - Intergenic
1168040425 19:53754251-53754273 TGAATCCAAGAGACCTAGGTGGG - Intergenic
927775837 2:25902399-25902421 AGTAGCTATTAGACCTTGGTGGG + Intergenic
928258904 2:29749381-29749403 TGTTTGTAAAAGACATAGGTTGG - Intronic
935463542 2:103367474-103367496 TGTAGACAAAATACCTAGTTGGG + Intergenic
939125922 2:138177333-138177355 TGGAGTTAAAAGACCTGGGTTGG - Intergenic
942622870 2:177866620-177866642 TGTAGCTGAAAGGCCTTAGTAGG + Intronic
946960500 2:224979925-224979947 TGGAGCCAGAACACCTAGGTTGG - Intronic
1172962697 20:38809676-38809698 TGTGGATAAAAAACCTAGCTTGG + Intronic
1174893293 20:54421127-54421149 TGTAGCAAAAATACGTAGCTGGG + Intergenic
1178094091 21:29195585-29195607 TATAGCTAAAACACCTAGCACGG - Intronic
950541016 3:13613021-13613043 TGGAGCTAGATGACCTAGGATGG + Intronic
950925625 3:16738315-16738337 TCTAGCTAATAGACCCAGCTGGG + Intergenic
952892158 3:38050602-38050624 TGTAGATGAATGCCCTAGGTGGG - Intronic
953228124 3:41039403-41039425 TGAAGCTCAAAGACAGAGGTTGG - Intergenic
956538695 3:70309174-70309196 TGGACCTCAAAGACCGAGGTTGG + Intergenic
959753597 3:109868905-109868927 TATAGCTCAAAGACATATGTAGG + Intergenic
962224674 3:133596069-133596091 TGGAGCCAAAACACCTGGGTTGG - Intergenic
970965757 4:21925887-21925909 TGGAGCTGGAAGACCTAGGTTGG + Intronic
979495646 4:121380012-121380034 TGTGGCTTAGAGACATAGGTTGG - Intronic
992342093 5:75834795-75834817 TATAGCAAAAATTCCTAGGTGGG - Intergenic
993149935 5:84148526-84148548 TGTAGCTTAAAGACTTAAATTGG + Intronic
995750951 5:115452745-115452767 TGTAGGAAAAAGGCCTAGATAGG - Intergenic
996254593 5:121383771-121383793 TGTATCTCAAAGACTTACGTAGG + Intergenic
999657451 5:153824751-153824773 TGTAGTTAAAAGTTCTGGGTTGG - Intergenic
1000950239 5:167472857-167472879 GGAAGCCAAAAGACCTAGCTGGG + Intronic
1001062755 5:168507666-168507688 TGGAGCTCAAAGACCTTGTTGGG + Intronic
1005773964 6:29108646-29108668 TGTATCAAAAATACCTGGGTCGG - Intergenic
1009936726 6:70242794-70242816 TGAAGGAAAAAAACCTAGGTAGG - Intronic
1010451297 6:76006122-76006144 TTTTTCAAAAAGACCTAGGTGGG - Intronic
1010453573 6:76029963-76029985 TTTAGGTAAAAGCCCTAGGAAGG + Intronic
1013548601 6:111184912-111184934 TGTAGCTATTAGACCTTGCTAGG + Intronic
1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG + Intronic
1016756968 6:147697877-147697899 TTTAGCTAAAAAAACTATGTAGG + Intronic
1022583090 7:31576686-31576708 TGTAGGTAAAAGAAAAAGGTAGG + Intronic
1025754109 7:64318807-64318829 TGTATCTAAAAGCCCTAGAGAGG + Intronic
1030516258 7:110542242-110542264 TTTATCTAAAAGACCTAAGTAGG - Intergenic
1031268027 7:119607285-119607307 TATTGCTAAAAGATGTAGGTGGG - Intergenic
1031720173 7:125164860-125164882 AGTAGCATAAAGACCTAGATAGG - Intergenic
1031787400 7:126050523-126050545 TGTAGTTAAAAGTCCAAGATTGG - Intergenic
1039387923 8:37152857-37152879 AGTAGCTAAAAGTCTTAGGTAGG + Intergenic
1041308181 8:56485341-56485363 TGTAGCCAAAAGACCAAGAAAGG + Intergenic
1042517196 8:69671927-69671949 TGTAACTAAAATACTCAGGTGGG + Exonic
1045067656 8:98465230-98465252 TCTAGCTGAGAGACCTAGGGTGG - Intronic
1045763329 8:105636948-105636970 GGTAGATAAAAGACTTAAGTAGG + Intronic
1051521579 9:17995126-17995148 TGTAGCTAAAAGACATTGCTGGG - Intergenic
1056751020 9:89351208-89351230 AGTAGATGAAAGCCCTAGGTAGG - Intronic
1187533618 X:20117718-20117740 TGTCGTTGAAAGGCCTAGGTCGG - Intergenic
1189647312 X:43147558-43147580 TGGAGCTAAAAGCCCTATATGGG - Intergenic
1198993626 X:142546714-142546736 TTAAGCAAAAAGACTTAGGTTGG - Intergenic
1199925888 X:152463589-152463611 TGAAGCAAAAATACATAGGTGGG + Intergenic