ID: 1094335345

View in Genome Browser
Species Human (GRCh38)
Location 12:29344337-29344359
Sequence AGTGGCATAATCTTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094335345 Original CRISPR AGTGGCATAATCTTTGAGGA AGG (reversed) Intronic
904790724 1:33018599-33018621 AGTGACATGCTCTGTGAGGACGG + Intronic
905015954 1:34778551-34778573 AGTGGCATGATCTATTAGGTTGG + Intronic
905122808 1:35694890-35694912 AGTGGCATAATCTTGGCTCATGG + Intergenic
905862370 1:41360220-41360242 AGTGGGAGAATCTCTGATGAGGG + Intergenic
907800472 1:57760148-57760170 GGTGCCATGATATTTGAGGAAGG + Intronic
913093965 1:115498701-115498723 TGAGGCAGAATCTTAGAGGATGG - Intergenic
913409181 1:118532181-118532203 AGTCACATAGCCTTTGAGGATGG + Intergenic
915964518 1:160294630-160294652 AGTGGCATAATCTTAGCCAAAGG + Intronic
916537149 1:165714240-165714262 AGTTGAATAATCCTTGAAGAAGG - Intergenic
917722959 1:177803469-177803491 ACTGTCATAATCTTTGAGAAGGG - Intergenic
919843597 1:201626971-201626993 AATGGCAGAAACATTGAGGAAGG - Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
1063783599 10:9354410-9354432 AGTGGCATAATCTTGGCTTACGG - Intergenic
1064731287 10:18333313-18333335 AGAGGGATAAACTCTGAGGAAGG + Intronic
1066136881 10:32456528-32456550 AGTGGCATAATCTTTGCATTTGG - Intronic
1068063118 10:52094849-52094871 AGTGTGATAATCTTTGGAGATGG - Intronic
1068520286 10:58069989-58070011 ACTGGCCAAACCTTTGAGGATGG - Intergenic
1070703627 10:78621407-78621429 AGTGGCATCATCTTAGAGATAGG - Intergenic
1070997135 10:80794919-80794941 AGTGGCCCATTCTTTGAGCATGG - Intergenic
1071710835 10:88047543-88047565 AGTCACATTACCTTTGAGGAAGG - Intergenic
1075221339 10:120587622-120587644 AACGGGATAATTTTTGAGGACGG - Intronic
1078470565 11:11582734-11582756 AGTTGCATCACCTTTGATGAGGG - Intronic
1078786012 11:14493239-14493261 ACTGTCAGAAGCTTTGAGGAAGG - Intronic
1086316103 11:85594384-85594406 AGTGGCAAAATCTTAGAAAAGGG - Intronic
1086381579 11:86260565-86260587 AGCTGCATAATTTTTGAAGAGGG + Intronic
1086573348 11:88309412-88309434 AGTGGTACAATCTTTCAGGAAGG + Intronic
1087890358 11:103531131-103531153 GGAGGCATAATCTCTGAGGTAGG + Intergenic
1091652959 12:2323446-2323468 AGTGGCAGAATCTGAGAGGACGG + Intronic
1094335345 12:29344337-29344359 AGTGGCATAATCTTTGAGGAAGG - Intronic
1094699500 12:32855058-32855080 ACTGGCATAATCTTTCAGGAAGG + Intronic
1094755859 12:33467541-33467563 TGTGGCATTATTTTTGAGGCCGG - Intergenic
1097342347 12:58453576-58453598 ACTGGGAGAATCTATGAGGAAGG - Intergenic
1099755981 12:86848896-86848918 AGTAACATAGTCTCTGAGGAAGG + Intergenic
1104109760 12:125694078-125694100 AGTGGCACAATCTTTGTTCATGG - Intergenic
1104705632 12:130944465-130944487 AGTGGCATAATATTATTGGAAGG - Intergenic
1106400703 13:29427536-29427558 ATTAGCATAATCCTTCAGGAAGG - Intronic
1107281080 13:38735991-38736013 AGGAGCATAATCTTCCAGGAGGG + Intronic
1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG + Intergenic
1109227408 13:59713606-59713628 AGTGAGTTAATATTTGAGGAAGG + Intronic
1110191660 13:72736743-72736765 ACTGGTATAACCTTTTAGGAGGG - Intronic
1112871560 13:103977261-103977283 AGTTGCATAATCTTGGTGAAAGG + Intergenic
1112917289 13:104567179-104567201 AGTGGTATCATCGTTGAGGAAGG + Intergenic
1113398167 13:109968253-109968275 AGTGGAAGCATCTGTGAGGAAGG + Intergenic
1114335393 14:21684237-21684259 ATTGGCAAAATATTTGAGGAGGG - Intergenic
1114808034 14:25860535-25860557 ACTGGCAAAATCTGTGAGGAGGG + Intergenic
1114938220 14:27572272-27572294 AGTGTCATAAATTTTAAGGAAGG - Intergenic
1115633524 14:35268651-35268673 AGTGGCACAATCTTTGCTCATGG + Intronic
1119044255 14:71303723-71303745 AGGGGAATAATCACTGAGGATGG + Intergenic
1119487617 14:75001908-75001930 ATTGACATAATCTTTTTGGAGGG + Intergenic
1119571106 14:75673394-75673416 AGTGTTATAACCTTTGAAGATGG - Intronic
1120458050 14:84757480-84757502 AGTGGCAAAATCCCAGAGGAAGG - Intergenic
1120968927 14:90191506-90191528 AGTGGCATGATCTCTGATGCTGG - Intergenic
1123481811 15:20639415-20639437 AGTGTCAGAAACCTTGAGGAAGG - Intergenic
1123636202 15:22360950-22360972 AGTGTCAGAAACCTTGAGGAAGG + Intergenic
1125294548 15:38188197-38188219 ATAAGCATAATCTTTCAGGAAGG + Intergenic
1125555885 15:40584290-40584312 ATTGGTATAATCTTTTTGGAGGG - Intergenic
1125983774 15:44028948-44028970 AGTGACATTTTCTCTGAGGAAGG + Intronic
1126011911 15:44311178-44311200 AGTGGCATAATCTATAAGAATGG - Intronic
1126096328 15:45093455-45093477 AGTGTCAGCAACTTTGAGGAGGG - Exonic
1126845982 15:52760989-52761011 AGTGGCATAACCTTTGGCCAAGG - Intronic
1127582989 15:60354683-60354705 AGTGGTAAAATCATTGAGCAAGG + Intronic
1128296300 15:66522878-66522900 AGTGGCATAATCTCAGCTGACGG + Intronic
1130691108 15:86082194-86082216 TGTGGAATAATCTTTCATGATGG + Intergenic
1131847598 15:96504213-96504235 AGTGGGCTAATGCTTGAGGAGGG + Intergenic
1132654256 16:1035280-1035302 AGGGGCAGAATCTCTGGGGAGGG + Intergenic
1134596571 16:15500514-15500536 GGAGACAGAATCTTTGAGGAAGG + Intronic
1136341493 16:29646846-29646868 AGTGGCATAATCTTGGCTCATGG + Intergenic
1138127617 16:54451958-54451980 AGTGACACAAAATTTGAGGAGGG + Intergenic
1140098752 16:71896273-71896295 AACAGCATAAACTTTGAGGAGGG + Intronic
1143678894 17:8461195-8461217 TGTGCCATAATTATTGAGGACGG - Intronic
1146703525 17:34982264-34982286 AGTGGCTTGATTTCTGAGGATGG + Intronic
1149356895 17:55848377-55848399 AGTGGCATCTTCTGGGAGGAGGG + Intergenic
1149668173 17:58381088-58381110 AGTGGCAAAATTATGGAGGATGG + Intronic
1150167579 17:62958624-62958646 AGTGGCATAATCTTTGTATGTGG + Intergenic
1152897258 17:82919764-82919786 AGTGGCAGTATCTGTGACGATGG + Intronic
1153839878 18:8997234-8997256 ATTGGCATAACATTTCAGGAAGG - Intergenic
1154246621 18:12704815-12704837 AGTAGCAAAATCGTTGAGAAGGG + Intronic
1154249439 18:12731306-12731328 AGTGGCACAATCTTGGATCATGG + Intergenic
1157113465 18:44842534-44842556 TGTGGGATATTCTTTGGGGAAGG - Intronic
1157209480 18:45729309-45729331 AGTGGCATAATCCCAGAGGCAGG - Intronic
1157262615 18:46189155-46189177 AGTGGCATAATCTTGGCTCACGG - Intronic
1161519483 19:4715769-4715791 AGTGGGATATTCTTTGGGGAAGG - Intronic
1161675670 19:5647210-5647232 AGTGGCATCTCCTTTCAGGAAGG - Intronic
1168620042 19:57870920-57870942 AGTGGCATAATCTTGGCTCACGG - Intronic
926162720 2:10500161-10500183 AGTTGCAGAATCTTGGAGGCTGG - Intergenic
930564201 2:52999192-52999214 AGTGGCATAATCTTGGCTCATGG + Intergenic
932136001 2:69229132-69229154 AGTGGGATAGTATTTGAGGGTGG - Intronic
933211529 2:79575420-79575442 AGTTTCATATTCCTTGAGGAGGG - Intronic
935408312 2:102733068-102733090 AGTGGCATAATGCTTGAGAAAGG + Intronic
939389499 2:141547972-141547994 AGTGGCAGAGACTTTGAGAAAGG + Intronic
939390482 2:141562827-141562849 AATTGCATATTTTTTGAGGAAGG + Intronic
939756793 2:146123726-146123748 AGTGGCAGAAACTTCCAGGAAGG + Intergenic
940509578 2:154595939-154595961 ATTGGCATAAGCTTTTTGGAGGG - Intergenic
942244713 2:173997097-173997119 TGGGGCAGAATCTTTGAGCAAGG - Intergenic
943119258 2:183713393-183713415 GGTGGAATAAGCTTTGTGGAAGG - Intergenic
945631216 2:212279672-212279694 ATTGGCATATTTTTTGAAGAAGG - Intronic
945816152 2:214607450-214607472 AGTGGGAGAATCTCTGAGCAGGG + Intergenic
946443431 2:219716656-219716678 AATGGCATAATTTTTATGGAGGG + Intergenic
947675695 2:231977462-231977484 AGTGGGATACTCTTTGGGTATGG - Intronic
1171313072 20:24161437-24161459 AGAGGCAAATTTTTTGAGGAGGG - Intergenic
1171965973 20:31530916-31530938 AATGGCACAATCTTTTTGGAGGG - Intronic
1173078791 20:39846281-39846303 CGTGGCATCACCTTTGAGGTAGG - Intergenic
1173499908 20:43545595-43545617 AGTGGCAGACTCCTTGAGAAAGG + Intronic
1175235636 20:57508877-57508899 AGTGGACTCATCTTTGGGGAGGG - Intronic
1177260238 21:18720153-18720175 AGTTACATAATATTTGAGGATGG - Intergenic
1180639448 22:17286676-17286698 AGAGGCAGAGACTTTGAGGACGG + Intergenic
1182373134 22:29826372-29826394 AGTGGCATAATCTTGGCTCACGG + Intronic
1184611136 22:45604109-45604131 AGTGGCAGAATCTAGGTGGAAGG - Intergenic
949089945 3:15279-15301 AGTGGCTTAGACTGTGAGGATGG - Intergenic
950192486 3:10987268-10987290 AGTGGCATAATCTTGGCTCACGG - Intergenic
950384623 3:12648447-12648469 TGTGTCCTTATCTTTGAGGAGGG - Intronic
951016126 3:17734742-17734764 ACTGGCATAATCTTTTTGGTAGG + Intronic
953450789 3:43004130-43004152 AGTGGCAGAATGAGTGAGGAAGG + Intronic
954892160 3:53940649-53940671 AATGGGATAGTCTTTGTGGAGGG + Intergenic
957869840 3:86077190-86077212 AGTGGCATAATCTTTATTGCAGG + Intergenic
959000851 3:100962686-100962708 AGTGGGAGAATATTTGAAGAAGG - Intronic
959159134 3:102703030-102703052 AGTGGCATAATCTCGGATCACGG + Intergenic
961969897 3:130951497-130951519 ATTGGCATTATCTTTGAAGAAGG + Intronic
963784995 3:149525500-149525522 ACTTGTATAATCTATGAGGAAGG + Intronic
964452846 3:156828236-156828258 AGTGGCATTATCTTTGTAAATGG - Intronic
966070055 3:175865032-175865054 AGTGCCATAAACTTTCAGCATGG - Intergenic
966933131 3:184688587-184688609 AGTGGAAGGATCTTGGAGGAGGG + Intergenic
967735452 3:192947094-192947116 TTTGACATAATCTTTGAAGAAGG + Intergenic
970167939 4:13259712-13259734 AGTGGCATAATGTGTGTGAAAGG + Intergenic
971504803 4:27354957-27354979 GGTTTCATCATCTTTGAGGAGGG + Intergenic
971576160 4:28278366-28278388 AATGGAATAATCTTTGAAAAGGG - Intergenic
971835939 4:31762739-31762761 AGTGACATGTTCTTTGAAGATGG - Intergenic
973168257 4:47105740-47105762 AATGGCATAAGCCTGGAGGAGGG - Intronic
975625546 4:76343019-76343041 AGAGGCTTAATCTTTGGGTAAGG + Intronic
977090438 4:92667916-92667938 AAGGTCATAATCTTTGAAGAGGG - Intronic
978057945 4:104296253-104296275 AGGGGCAGTATGTTTGAGGAAGG + Intergenic
978250780 4:106629103-106629125 AGTGGCATATTCCTTAAGCATGG + Intergenic
981220448 4:142226513-142226535 ATTGGAATTATCTTTTAGGAAGG - Intronic
984217553 4:176932884-176932906 ATTGACATAATCCTTGTGGAAGG + Intergenic
988681238 5:33486128-33486150 AGTGGCACAATCTTGGTGCATGG + Intergenic
990090753 5:52044484-52044506 AATGGCATAGTCTTTGTGTATGG - Intronic
990956825 5:61349483-61349505 TGTGGCATAGTCTTTGAGGGAGG + Intronic
995101945 5:108322107-108322129 AATGGCATAATCTCTAAGGAAGG + Intronic
996322796 5:122238171-122238193 TTAGGCATTATCTTTGAGGAAGG - Intergenic
997890046 5:137668063-137668085 AATTGCATAATGTTTGAGCATGG - Intronic
999606617 5:153323811-153323833 ATGGGCATAATCTTTGTGGTAGG + Intergenic
1000115535 5:158150089-158150111 AGAGGCATAATCTTGGACCAAGG + Intergenic
1001084655 5:168691880-168691902 AGTGGCAAAAGCTTTCATGAAGG + Intronic
1003766595 6:9243901-9243923 AATGGCATAAACTTTGTGGTCGG + Intergenic
1004241439 6:13925401-13925423 CATGGCATTCTCTTTGAGGAGGG + Intronic
1006102630 6:31695197-31695219 ACTGTGATTATCTTTGAGGATGG - Intronic
1007021246 6:38523596-38523618 ATTTGGATAATCTTAGAGGAGGG - Intronic
1007654457 6:43443935-43443957 AGTGGCAGAATCTCAGAGGGAGG - Exonic
1010206762 6:73329430-73329452 AGTGGCATAATCCTGGCTGACGG + Intergenic
1010407658 6:75523009-75523031 AGTAGCACAATGTTTGAGCAGGG + Intergenic
1010926940 6:81754621-81754643 AGTTGGAGAATGTTTGAGGAAGG + Intergenic
1012571305 6:100733110-100733132 AGTGTCAAAAGCTTTGAGCAAGG - Intronic
1013815466 6:114092472-114092494 AGTGGCACAATGTATGAGGCAGG + Intronic
1014995922 6:128144159-128144181 AGAAGCATCATGTTTGAGGAAGG - Intronic
1015508960 6:134018543-134018565 AGTGTGACAATCTTGGAGGAGGG - Intronic
1016533058 6:145079643-145079665 AGTGGCATAATCTTGGCTCACGG + Intergenic
1021471895 7:21012725-21012747 AGTTGCAAAATTTATGAGGATGG - Intergenic
1021936600 7:25637668-25637690 TGTGGCATTATCTATAAGGATGG - Intergenic
1022364510 7:29698589-29698611 AGTGGCACAAACCTTGAGGATGG + Intergenic
1022696847 7:32715149-32715171 AGTGGCACAAACCTTGAGAATGG - Intergenic
1024142130 7:46472236-46472258 AATGGCATAATCTTTTGGGATGG + Intergenic
1027365586 7:77454487-77454509 ATTGGAATAAACTTTCAGGAAGG + Intergenic
1027631546 7:80611770-80611792 GGTGTCTTAATCTTGGAGGAGGG + Intronic
1028476619 7:91260745-91260767 TGTTGCTTAAACTTTGAGGAAGG - Intergenic
1029367604 7:100126801-100126823 AGCGCCATTAGCTTTGAGGAGGG - Exonic
1030237788 7:107285622-107285644 AGTGACTTAATATTTGTGGAAGG - Intronic
1030715854 7:112805993-112806015 AATGGAATAATATTTTAGGAAGG - Intergenic
1034360055 7:150487408-150487430 AGTGGCATAACCAATGTGGAGGG - Intergenic
1038324149 8:26559376-26559398 ATTGGTACAATCTTTGTGGAAGG - Intronic
1039752297 8:40489640-40489662 GGCAGCAAAATCTTTGAGGAAGG + Intergenic
1041764552 8:61404725-61404747 AGTTGCATATTGTTTGAGGATGG + Intronic
1047145817 8:122198167-122198189 AGTGGCAAAATATATGAGGTGGG + Intergenic
1047429619 8:124779843-124779865 ATTGGCATAAACTTTTGGGAAGG - Intergenic
1048476202 8:134744351-134744373 AGTGGCATAATCTTGGCTCACGG + Intergenic
1048603931 8:135947891-135947913 AGTTTCCTGATCTTTGAGGAGGG + Intergenic
1050335196 9:4583668-4583690 AGTTGCATAATCTGTGAGATGGG + Intronic
1053099152 9:35354807-35354829 ATTGGCATAATCTCTAAGGAAGG + Intronic
1053604692 9:39645315-39645337 AGTAACAAAATCTTCGAGGAGGG - Intergenic
1054248850 9:62697101-62697123 AGTAACAAAATCTTCGAGGAGGG + Intergenic
1054562961 9:66731627-66731649 AGTAACAAAATCTTCGAGGAGGG + Intergenic
1055473420 9:76636896-76636918 AGTGGCATGATCTTGGATCACGG - Intronic
1058655543 9:107217281-107217303 AATGGAATAACCATTGAGGAAGG + Intergenic
1186180120 X:6965548-6965570 ATTGTCACAATCTTTGAGGCAGG - Intergenic
1186722424 X:12319594-12319616 AGTGACATAATGCTTGAGGCAGG + Intronic
1187037275 X:15553916-15553938 TGTGGCAGAATCTGTGAAGAGGG + Intronic
1187591446 X:20721571-20721593 AGTGACATAATCTCTCAGGTAGG - Intergenic
1190452802 X:50597894-50597916 AGTGGCACAATCTTTGCTCACGG + Intronic
1191130242 X:57000062-57000084 AGTGTGATAATATTTGAAGATGG - Intergenic
1191907687 X:66111352-66111374 AGTTGCATATTCTTAGAAGAGGG - Intergenic
1197054761 X:122104263-122104285 GATGGCATAATTTTTGAGAATGG + Intergenic
1197189735 X:123632904-123632926 AATGGGGTAATCTTTCAGGAAGG - Exonic
1197917422 X:131551410-131551432 GGTGGAATGAGCTTTGAGGAGGG - Intergenic
1199168283 X:144703794-144703816 AGTGTCATCATTTTTGACGAAGG - Intergenic
1200759530 Y:7025303-7025325 AGGGTCATTATCGTTGAGGAAGG - Intronic