ID: 1094336004

View in Genome Browser
Species Human (GRCh38)
Location 12:29354647-29354669
Sequence GTTCATATCTTGTCATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094336004_1094336006 -4 Left 1094336004 12:29354647-29354669 CCCTGAGATGACAAGATATGAAC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1094336006 12:29354666-29354688 GAACCAAATGCTTTTCTATTTGG 0: 1
1: 0
2: 0
3: 18
4: 229
1094336004_1094336009 25 Left 1094336004 12:29354647-29354669 CCCTGAGATGACAAGATATGAAC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1094336009 12:29354695-29354717 TGATAGTGTGAGTTACCACCTGG 0: 1
1: 0
2: 1
3: 6
4: 90
1094336004_1094336010 26 Left 1094336004 12:29354647-29354669 CCCTGAGATGACAAGATATGAAC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1094336010 12:29354696-29354718 GATAGTGTGAGTTACCACCTGGG 0: 1
1: 0
2: 0
3: 1
4: 71
1094336004_1094336011 30 Left 1094336004 12:29354647-29354669 CCCTGAGATGACAAGATATGAAC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1094336011 12:29354700-29354722 GTGTGAGTTACCACCTGGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094336004 Original CRISPR GTTCATATCTTGTCATCTCA GGG (reversed) Intronic
902544499 1:17181072-17181094 CTTCATATCTTTTGATGTCAGGG - Intergenic
905874473 1:41423416-41423438 CTTCATCTCTTTTCATCTGATGG - Intergenic
907598645 1:55744777-55744799 GTGGATATTTTCTCATCTCAAGG + Intergenic
908134491 1:61116087-61116109 GCTGATTTCTTGTCATCTTAGGG + Intronic
910097709 1:83542711-83542733 CTACATCTCTTGTCTTCTCAGGG - Intergenic
911542060 1:99168858-99168880 GTTAATTTCTTGTCATCTCTAGG + Intergenic
912161857 1:106995283-106995305 CTTCTTATCATGCCATCTCAAGG - Intergenic
912241880 1:107919165-107919187 TTTAATATATTGTCATCTAAAGG - Intronic
913649772 1:120901556-120901578 TTTCTCATCTTGTCTTCTCATGG - Intergenic
914076912 1:144361972-144361994 TTTCTCATCTTGTCTTCTCATGG + Intergenic
914102266 1:144604533-144604555 TTTCTCATCTTGTCTTCTCATGG - Intergenic
914171361 1:145227541-145227563 TTTCTCATCTTGTCTTCTCATGG + Intergenic
914296632 1:146332663-146332685 TTTCTCATCTTGTCTTCTCATGG + Intergenic
914526470 1:148471507-148471529 TTTCTCATCTTGTCTTCTCATGG + Intergenic
914639934 1:149595615-149595637 TTTCTCATCTTGTCTTCTCATGG - Intergenic
918308439 1:183268018-183268040 GATCATATCTTTTCATCTTCTGG + Intronic
918396680 1:184120244-184120266 GTTCAATCCTTTTCATCTCATGG + Intergenic
918973912 1:191455794-191455816 GTGCATATCTGCTCTTCTCAAGG + Intergenic
919760003 1:201091876-201091898 CTTCCTACCTTGACATCTCAGGG - Intronic
920359827 1:205407023-205407045 GTTCAAATCTTCTTATCACATGG - Intronic
921717890 1:218437042-218437064 GCTTATATCTGGTCATCTGAAGG + Intronic
924161374 1:241236061-241236083 GTTCTCTCCTTGTCATCTCATGG - Intronic
1064344701 10:14521512-14521534 TTTCAATTCTTGTCATCTCGTGG - Intronic
1064856289 10:19771877-19771899 GTTCCCATCTTCTCATGTCATGG - Intronic
1070548970 10:77475660-77475682 CTTAATATCTTGTTATCACATGG + Intronic
1072317642 10:94219094-94219116 ATTGATAGCTTGGCATCTCATGG - Intronic
1075364239 10:121869551-121869573 GCTCTTCTCTTGTCAACTCATGG + Intronic
1075544655 10:123345942-123345964 CATCATATGTTGTCATTTCAGGG - Intergenic
1076170409 10:128314723-128314745 TTTCAGATGTTGTCAACTCAAGG + Intergenic
1077022340 11:423316-423338 GCTTATATATTGTCTTCTCATGG - Intronic
1080060936 11:27956077-27956099 GTTCATATCCTATCAGATCATGG + Intergenic
1081314816 11:41619142-41619164 GTTCATAACTTCCCACCTCACGG - Intergenic
1082244702 11:49907970-49907992 GTACATATGTTGAAATCTCAGGG + Intergenic
1083047939 11:59753644-59753666 GTTCATATCTCGGCCTCTCGCGG + Intronic
1084304858 11:68275529-68275551 GTTCATACCTTGGCTTTTCAGGG - Intergenic
1087033973 11:93737449-93737471 GTACATATCTTGTCATGTCTGGG + Intronic
1088161723 11:106879817-106879839 TTTCAAATCTTTTCATTTCATGG - Intronic
1089344795 11:117784291-117784313 GTTCATATTTTACCATCACAAGG + Intronic
1091210441 11:133853974-133853996 GTTCAGATTTTTTCATCCCATGG + Intergenic
1093714224 12:22363201-22363223 GTTAATATTTTGCCATTTCAAGG - Intronic
1094336004 12:29354647-29354669 GTTCATATCTTGTCATCTCAGGG - Intronic
1099444377 12:82734726-82734748 GTACATGTCCTGGCATCTCAGGG - Intronic
1107405298 13:40106695-40106717 GTTCAAACCTAGTCAGCTCAGGG + Intergenic
1108468142 13:50739604-50739626 GTTCATATCTGGTCCCCTCCAGG - Intronic
1109517416 13:63462280-63462302 CTTTATATCTTATCATCTAATGG + Intergenic
1111357623 13:87129319-87129341 GTGCCTATCTTCTCATTTCAAGG - Intergenic
1111441130 13:88283639-88283661 GGTCTTATCTTTTCATCTGATGG - Intergenic
1120370896 14:83633694-83633716 GTTCATTTCTTGTCAGCTTGTGG - Intergenic
1120606801 14:86589123-86589145 TTTCATATTTTCTCTTCTCATGG + Intergenic
1121232330 14:92366853-92366875 GTCCATTTCTTTTCAGCTCATGG + Intronic
1122084776 14:99291942-99291964 GTTCACATATTGCCTTCTCAAGG + Intergenic
1130445639 15:83998788-83998810 GATCTTATCTAGTTATCTCAGGG - Intronic
1137732832 16:50701706-50701728 GTTCACATCCTGTCTTCTCTGGG - Intronic
1138543742 16:57704457-57704479 TTTCAGATCTTGTCATCGGAGGG - Intronic
1145922610 17:28621765-28621787 GTTCAAATCTAATCATGTCATGG + Intronic
1146680641 17:34805277-34805299 TTTTTTATCTTGTCACCTCATGG - Intergenic
1154359618 18:13648533-13648555 GTTCATACCGTGTCGCCTCATGG + Exonic
1155117822 18:22786788-22786810 TTTCATATGTGGTCATCTCTAGG + Intergenic
1156376816 18:36521990-36522012 GTTCAGATATTGTAATCTCCAGG + Intronic
1157185742 18:45538806-45538828 GGTCATTTCTTCTCATCTCATGG - Intronic
1159267634 18:66103873-66103895 GTATAAATCTTGTCATGTCATGG - Intergenic
1162619261 19:11827925-11827947 GTGCCTCTCTTGTCATCTTATGG + Intronic
1162627989 19:11901225-11901247 GTGCCTCTCTTGTCATCTTATGG + Intronic
926225342 2:10963112-10963134 GGACATATCTTTTCATCTCTTGG + Intergenic
928929257 2:36607132-36607154 TTTCATGTTGTGTCATCTCAAGG + Intronic
929252452 2:39774170-39774192 GATCCTATCTTGGCAGCTCAGGG - Intronic
929950794 2:46408310-46408332 GCCCATATCTAGTCATCTCTAGG - Intergenic
931903057 2:66811912-66811934 ATTCAAATCATGTCATCTAAAGG + Intergenic
933653270 2:84866021-84866043 GATTTGATCTTGTCATCTCAGGG - Intronic
935036799 2:99384623-99384645 GTTTATATTTTGTCCTCTTATGG - Intronic
938111974 2:128573867-128573889 GTTCCTATCTTCCCCTCTCATGG - Intergenic
938820017 2:134948369-134948391 ATTCTTATCTTGTCAGCTTATGG - Intronic
941576557 2:167239896-167239918 GTTCATTTCTTGCCATTTCCTGG - Exonic
941809101 2:169738148-169738170 GTTTATATCTAGTCATCCCAGGG + Intronic
947184028 2:227438924-227438946 ATTCATATGTTGAAATCTCAAGG + Intergenic
1169432485 20:5550815-5550837 GCTCATATCTTTTCCTCTCTTGG - Intronic
1170375791 20:15699242-15699264 GTTCATATTTTTTCGTCCCATGG + Intronic
1172908286 20:38385973-38385995 TCTCATATCTTGTCTTCTGATGG + Intergenic
1175120350 20:56711736-56711758 GTTCAAATCATGTCTTCTCCAGG - Intergenic
1179482373 21:41686311-41686333 TTGCACATCATGTCATCTCAAGG + Intergenic
1182070244 22:27458460-27458482 ATTCATATCCTGTCATCACCAGG - Intergenic
1183697243 22:39430399-39430421 GTTCATACCTTGTCACCACCCGG + Exonic
1184090257 22:42289518-42289540 ATTCCTACCTTGCCATCTCAGGG - Intronic
949102728 3:165447-165469 TTTAATATCTTCTCATTTCATGG + Intergenic
950660972 3:14466856-14466878 GTGCATCTCTTTTCATGTCAAGG + Intronic
950753511 3:15151885-15151907 TTTGATTTCTTGTCTTCTCAGGG - Intergenic
957652080 3:83020585-83020607 ATTCATACCTTCCCATCTCAAGG + Intergenic
957810952 3:85222050-85222072 GTGTATATCTTTTTATCTCATGG - Intronic
964653753 3:159043334-159043356 GTTGATATCTGGGCATCCCATGG + Intronic
965959417 3:174411079-174411101 GTTGATACCTTGTCACCTCCTGG - Intergenic
971131201 4:23812956-23812978 GAGAACATCTTGTCATCTCAAGG + Intronic
971465259 4:26951467-26951489 GTTTGTTTCTGGTCATCTCAGGG + Intronic
971755401 4:30701349-30701371 GTTCATGCCTTGTCTTCTCATGG - Intergenic
975838241 4:78447180-78447202 GTTCCCATATTGTCTTCTCAGGG + Intronic
976176293 4:82356254-82356276 GTTCAGATCTTTTAAGCTCAAGG - Intronic
982259104 4:153478692-153478714 ATTTATATCTTGTGAGCTCATGG + Intronic
982592085 4:157326220-157326242 TTTCAAATCCTGTCTTCTCATGG + Intronic
983271308 4:165565326-165565348 TTTGACATATTGTCATCTCATGG + Intergenic
983583110 4:169328665-169328687 GATGATAACTTGTAATCTCAAGG - Intergenic
983929146 4:173434262-173434284 GATCATATCCTATTATCTCAAGG - Intergenic
984291400 4:177799549-177799571 TTGCATATCTGGTCATCTCTTGG - Intronic
984617642 4:181916482-181916504 TTCCTTATCTTTTCATCTCAGGG - Intergenic
984861705 4:184246231-184246253 TTTCCTTTCTTGTCTTCTCATGG - Intergenic
986924944 5:12735189-12735211 GATCATATGTTGTCATCGTAAGG - Intergenic
987567411 5:19609820-19609842 GTTCATATCCTGTCATCAAATGG - Intronic
988322474 5:29716633-29716655 TTACATGTGTTGTCATCTCATGG + Intergenic
990412343 5:55553465-55553487 GTGCCTATCTTGTCAGTTCAGGG - Intergenic
991561868 5:67962330-67962352 GTTCATCTCTTGATAGCTCATGG + Intergenic
993052433 5:82940876-82940898 GGTCATGGCTTCTCATCTCATGG + Intergenic
993422022 5:87714506-87714528 GTTCCACTCTTGTCATCTCGGGG - Intergenic
993769818 5:91913260-91913282 GTTCATATATTGTGATCATAAGG + Intergenic
994855095 5:105110316-105110338 GGTGATATCTTGTTTTCTCAGGG + Intergenic
995873974 5:116770998-116771020 GTTTCTTTCTTGGCATCTCAGGG - Intergenic
997032473 5:130147093-130147115 CTTCATATGTTTTTATCTCATGG + Intronic
998593394 5:143501682-143501704 CTCCATAGCCTGTCATCTCAGGG - Intergenic
998881617 5:146651144-146651166 TTTTATGTCTTTTCATCTCATGG + Intronic
1000315080 5:160082612-160082634 GTTAATATTTTGGCATTTCAGGG - Intronic
1003237568 6:4310054-4310076 GTTGATATCTGCTCATCTAACGG - Intergenic
1004546622 6:16604061-16604083 CTCCTTATCTTGTCCTCTCATGG + Intronic
1005208733 6:23435079-23435101 ATCCATATCTTGTCTTTTCAGGG + Intergenic
1005956550 6:30667738-30667760 CTTCATATTATGTCATATCACGG - Intronic
1007483696 6:42166487-42166509 GTTAATATCTTTGCATCTTAAGG - Intronic
1008022851 6:46600501-46600523 GTTCCAATCCTCTCATCTCATGG - Intronic
1009404534 6:63295705-63295727 GGGCATATCCTGTCATGTCAAGG - Intronic
1010648835 6:78426744-78426766 GTTCATTTGTTTTCATCTCTAGG + Intergenic
1011777459 6:90747994-90748016 CTTCTTCTCTTCTCATCTCATGG - Intergenic
1013554784 6:111245266-111245288 GATCAAATCTTGACATCTCCAGG - Intergenic
1014098711 6:117486674-117486696 GTTTAGATGTTGTCCTCTCAGGG + Intronic
1020921844 7:14275223-14275245 GTGCATATCTTCTCATCTTAAGG + Intronic
1022389272 7:29929217-29929239 GTTCACATCTTCTCAGCTCCAGG + Intronic
1023552829 7:41388030-41388052 GTTCTTTTCCTGTCATCTCAGGG + Intergenic
1023567403 7:41537240-41537262 GTTTTCATCTTGTCATCTCCTGG + Intergenic
1024909208 7:54426138-54426160 TTACATTTCTTTTCATCTCAAGG - Intergenic
1028486272 7:91361000-91361022 GATAATATTTTGTCATCTCGTGG - Intergenic
1028629044 7:92913585-92913607 GTTCACTTCTTGACTTCTCATGG - Intergenic
1030354869 7:108530790-108530812 CTTCAAATCTTGCCCTCTCATGG - Intronic
1032257579 7:130309444-130309466 GTTCATATCTACACATCTAAGGG - Intronic
1033898823 7:146110801-146110823 GTTAATATGATTTCATCTCAGGG - Intergenic
1039300429 8:36203049-36203071 GCTCATGTCTTGTCCTCTCTGGG - Intergenic
1040715031 8:50240880-50240902 TTTCATATTTTTTAATCTCAAGG + Intronic
1041484553 8:58359788-58359810 GTTGATATCTTGACATCTGGTGG - Intergenic
1042717913 8:71795086-71795108 GTTAATATTTTCTGATCTCATGG - Intergenic
1046444878 8:114305189-114305211 GTTCATATCTTGTCCCGACAGGG - Intergenic
1046681756 8:117178386-117178408 GTTCATGTGTTGTCAAATCATGG + Intergenic
1047379587 8:124346586-124346608 GTTCCTTTTCTGTCATCTCAGGG - Intronic
1047589497 8:126312188-126312210 CTACATATCTGGGCATCTCATGG + Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1053540026 9:38963887-38963909 GTTCATAATTTGTTATCTTATGG + Intergenic
1053804377 9:41786044-41786066 GTTCATAATTTGTTATCTTATGG + Intergenic
1054140906 9:61529418-61529440 GTTCATAATTTGTTATCTTATGG - Intergenic
1054192682 9:61997535-61997557 GTTCATAATTTGTTATCTTATGG + Intergenic
1054626115 9:67400032-67400054 GTTCATAATTTGTTATCTTATGG - Intergenic
1054645723 9:67591156-67591178 GTTCATAATTTGTTATCTTATGG - Intergenic
1056170961 9:83983936-83983958 TTTCATAGCTTTTCATTTCATGG + Intronic
1056691758 9:88813844-88813866 GTTAACATCTTTTCATCTCTGGG + Intergenic
1058156977 9:101526809-101526831 GTTCATAAATTGTAATTTCAAGG + Intronic
1194341173 X:92707460-92707482 ATTTATGTTTTGTCATCTCATGG + Intergenic
1199346808 X:146750186-146750208 GTTCATATTGTGTCCTCACATGG + Intergenic
1201332291 Y:12837606-12837628 CTTCATCTCTTGTCAGATCAGGG - Intronic
1202084329 Y:21119847-21119869 GTTGATGTCTTGTCAAGTCAGGG + Intergenic