ID: 1094336134

View in Genome Browser
Species Human (GRCh38)
Location 12:29356332-29356354
Sequence CTTTAGACAAAGTTGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094336134 Original CRISPR CTTTAGACAAAGTTGGAGCT TGG (reversed) Intronic
904018788 1:27445344-27445366 GTTTGGACACAGTTGGACCTGGG - Intronic
905305323 1:37013860-37013882 CCCAAGACAAAGTTGGAGCAGGG + Intronic
905805781 1:40876408-40876430 CCTAACACAAAGTAGGAGCTTGG + Intergenic
910813757 1:91265948-91265970 CTTGACACATAGTTGGAGATGGG - Intronic
911028651 1:93462226-93462248 CTGTAGACAAATTTATAGCTTGG - Intronic
911077591 1:93893188-93893210 CTTTGGGCAAAGTTTGAACTTGG - Intronic
911372190 1:97007162-97007184 CTTTAGATAATGACGGAGCTAGG + Intergenic
912677852 1:111702001-111702023 CCTTAGACGAATTTGAAGCTGGG + Intronic
913203958 1:116518517-116518539 CATTAGAGAAAGATGGGGCTGGG - Intronic
913307652 1:117449796-117449818 CTTAAGAGAATGTTGTAGCTGGG - Intronic
914880040 1:151540121-151540143 ATTTACACAAAGGTGGGGCTTGG - Intergenic
915571916 1:156749530-156749552 TTTTAGATAAAGTTAGAACTGGG - Intronic
915955163 1:160214809-160214831 ATTTAGACAAAGTTCAAGTTAGG + Exonic
917675274 1:177312761-177312783 CTTTAGACAAAGCTGCTTCTAGG - Intergenic
918777194 1:188648845-188648867 AATTAGACAGAGTTGCAGCTAGG - Intergenic
922453094 1:225752342-225752364 TTTTAGACAAGGTGTGAGCTAGG + Intergenic
922815297 1:228444841-228444863 TTATAGACAAAATTGAAGCTGGG - Intergenic
923566928 1:235083340-235083362 ATTTAGACACAGTGGCAGCTGGG + Intergenic
1067999553 10:51316386-51316408 CTTAAGACAAAGTTGGGACGGGG + Intronic
1068436024 10:56992095-56992117 CTTTAGAGACAGTTTGAGCTGGG - Intergenic
1073248454 10:102107594-102107616 TTTTAAAAAAACTTGGAGCTGGG + Exonic
1073844317 10:107536056-107536078 CTTAAGGCCAAGTTGGAACTTGG - Intergenic
1074705767 10:116128871-116128893 CTTTGTACAAAGTTGGAACAGGG + Intronic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1076232745 10:128835307-128835329 CAGTAGGCAAATTTGGAGCTTGG - Intergenic
1080880178 11:36312448-36312470 CTTTACACCAAGTAGGTGCTTGG + Intronic
1082089527 11:48077965-48077987 ATTGAGACTAAGTTGGAGCTGGG + Intronic
1082893297 11:58163396-58163418 CCTTTGACAAAGGTGGAGCCAGG - Intronic
1083057486 11:59836933-59836955 CTTTGCACATAGTAGGAGCTAGG + Intronic
1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG + Intronic
1092260003 12:6947962-6947984 GGTTAGACCATGTTGGAGCTAGG + Intronic
1093474956 12:19544490-19544512 CATAAGACAAAGCTGGAGATAGG + Intronic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1095498261 12:42808424-42808446 CTTTAGAGAAAGTTAGAGTTTGG + Intergenic
1097841204 12:64323220-64323242 ATTTAGACACAGCTGGAACTGGG - Intronic
1100019943 12:90057152-90057174 CATAAGACAAAGTTGGACCAAGG - Intergenic
1100929298 12:99587054-99587076 AATTAGACAAAGTGGGAGCTAGG + Intronic
1101763581 12:107678845-107678867 CTTCAGACATAGCTGGATCTAGG - Intergenic
1103705591 12:122869901-122869923 ATTTAGATAAAGTCAGAGCTGGG - Intronic
1107586875 13:41859125-41859147 CTTTATGCAACGTTGGACCTTGG - Intronic
1108424214 13:50282193-50282215 CTTTAGACAAAGAGGGGCCTTGG + Intronic
1108531381 13:51330364-51330386 CTTTAGTCAAAGCTAGAGCCTGG - Intergenic
1110387569 13:74931808-74931830 CTTTACCCTAAGTTGGAGCTAGG - Intergenic
1113945347 13:114040914-114040936 CTTTAGCCACAGTCGGAGCCGGG + Intronic
1115196590 14:30807141-30807163 ATATAGACAAAGTTTGATCTAGG + Intergenic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1116915364 14:50520067-50520089 CATAAGACAAAGCTGGGGCTGGG + Intronic
1118039040 14:61897994-61898016 ATTAAGACAAAATTGGAACTTGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1126731130 15:51684243-51684265 CATGAGACATAATTGGAGCTTGG - Intronic
1131202143 15:90408185-90408207 CTTTTTACAAAGTAGGTGCTTGG + Intronic
1131713629 15:95084255-95084277 CTTAAGAGAATGTTGGTGCTGGG + Intergenic
1133644326 16:7749152-7749174 CTTTAGACACATTTGTAGCTAGG + Intergenic
1135007589 16:18840841-18840863 CTTGAGACAAATTTGGAGAGGGG - Intronic
1135283356 16:21172031-21172053 ATTTATACACACTTGGAGCTGGG - Intronic
1137868903 16:51930594-51930616 CTTTAGAAAATGTATGAGCTTGG + Intergenic
1138142436 16:54580454-54580476 CTTTAGACAAAGACTGAGGTGGG - Intergenic
1149488058 17:57059882-57059904 CTTCAGACACAGTTGGATCCAGG - Intergenic
1150665419 17:67131376-67131398 CTTCACAAAAAGCTGGAGCTTGG + Intronic
1154233311 18:12578469-12578491 ATTTATATGAAGTTGGAGCTGGG + Intronic
1154482128 18:14841016-14841038 CTTTAGAGAAAGATAGAGCATGG + Intronic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1157593938 18:48852460-48852482 TTCTAGAAAAAGTTGGAGGTGGG - Intronic
1158534376 18:58294339-58294361 TTTTAGAGTAAGTTGTAGCTAGG + Intronic
1163286212 19:16349755-16349777 CTTTAGAGCAAGTTGGAGTCAGG - Intergenic
1165073108 19:33267035-33267057 CTTCAGGCAAACTTGGGGCTCGG + Intergenic
1165252546 19:34552251-34552273 CTTTAAACAATGTTGGACCTTGG + Intergenic
1166064148 19:40346993-40347015 TTTTATACAAAGTGTGAGCTGGG + Intronic
1166925036 19:46261296-46261318 ATTTAGAAAAAGATGGGGCTGGG + Intergenic
1167004950 19:46769672-46769694 TTTTAGAAAAAGTTTGAGCCAGG + Intronic
1168327096 19:55544041-55544063 CTTGGGACAGAGTTGGACCTGGG + Intronic
925894656 2:8462100-8462122 ATCTAGACAAAAATGGAGCTTGG + Intergenic
929218247 2:39437602-39437624 CTAACGACAAAGTTGGACCTTGG + Intergenic
929490344 2:42390810-42390832 TTTCAGACAGATTTGGAGCTAGG - Intronic
929964167 2:46521222-46521244 CTTTAGAGGAAGTGTGAGCTGGG + Intronic
930016182 2:46972067-46972089 CTTCAGGCAAAGCTGGATCTAGG + Intronic
932001457 2:67888924-67888946 GTTGAGGCAAACTTGGAGCTGGG - Intergenic
932636305 2:73391230-73391252 CTGTAGATAAATTTGGAGATGGG - Intronic
936809361 2:116378050-116378072 CTTGAGACAAATTTAGAGGTAGG + Intergenic
939012501 2:136863053-136863075 TTTTAGGCAAGGTTGGAGCATGG - Intronic
939618511 2:144389279-144389301 ATGTAGACGGAGTTGGAGCTGGG - Exonic
940627271 2:156190879-156190901 CTTAAAACAACATTGGAGCTTGG - Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
944903781 2:204242608-204242630 CTTTAGTCTAAATTGTAGCTTGG - Intergenic
945539872 2:211072208-211072230 CTTTAGACAAGATGGGACCTTGG + Intergenic
1169041485 20:2499143-2499165 GTTTGGACAGAGTTGGAGGTAGG + Intronic
1172681029 20:36715520-36715542 TTTTAAACAACCTTGGAGCTGGG + Intronic
1173136649 20:40444529-40444551 CTTTAGAGAGAGCTGAAGCTAGG + Intergenic
1173455634 20:43199154-43199176 CTTCAGGCAAAGCTGGATCTAGG + Intergenic
1174087966 20:48023127-48023149 ATTTAGACAAAGCAGGAGATAGG + Intergenic
1176798478 21:13395608-13395630 CTTTAGAGAAAGATAGAGCATGG - Intergenic
1179386691 21:40950163-40950185 TTTTAGCCAAAGTGGGAGTTAGG + Intergenic
1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG + Exonic
951797126 3:26551847-26551869 CTTTAGGCAAAGTTGGAATTAGG - Intergenic
952237544 3:31495664-31495686 CTTTAGACAAAATTGGAAGAAGG - Intergenic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
961599007 3:128044268-128044290 CTTTAGGCAAAGATGGATTTAGG - Intergenic
964266666 3:154904688-154904710 ATTTAGAGGGAGTTGGAGCTGGG - Intergenic
965404478 3:168252154-168252176 CTTGAGAAAATTTTGGAGCTGGG + Intergenic
966760414 3:183413160-183413182 CTTTGAACAATGTAGGAGCTGGG + Intronic
968252392 3:197232438-197232460 TTTTAGAAAAAGCTGGAACTGGG + Intronic
968970667 4:3791892-3791914 CTTCAGAGTATGTTGGAGCTGGG - Intergenic
969136835 4:5036160-5036182 CTTTACACAAACTTTGAGCTAGG - Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
972928937 4:44047460-44047482 CTATAGACAATATTGGAGCTTGG + Intergenic
975871816 4:78787475-78787497 CGTTAGACAGAGTGGGAGCTGGG + Intronic
977064017 4:92290598-92290620 CTTTCTACTAATTTGGAGCTTGG + Intergenic
979946137 4:126833688-126833710 TTTTAAAAAAAATTGGAGCTGGG + Intergenic
980911118 4:138995416-138995438 CTTTAGGAAGAGCTGGAGCTGGG - Intergenic
982583485 4:157208413-157208435 ATTTAGACATAGATGAAGCTGGG + Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983732042 4:171007883-171007905 CTGGAGACCATGTTGGAGCTTGG + Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987170609 5:15253509-15253531 ATATAGACAAAGTAGGAGATGGG + Intergenic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
994313456 5:98304248-98304270 CTTTAGCCAAATTTGGAAATTGG - Intergenic
997021038 5:130002079-130002101 CTATAAACAAAGGTGGTGCTTGG + Intronic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
1000096577 5:157976312-157976334 CTTTATTGAAAGTTGGAGGTAGG + Intergenic
1000855065 5:166387995-166388017 CTTTAAACAAAGTTGAGGCTGGG + Intergenic
1001017345 5:168153500-168153522 CTTTAGCCAAAGTGGGTGCAGGG + Intronic
1006981275 6:38150226-38150248 TTTTGGACCAAGTGGGAGCTCGG + Intronic
1007831414 6:44641624-44641646 CAATAGACAAAGCTGGAGTTTGG - Intergenic
1008492814 6:52103626-52103648 TTTTACACTAAGTTGGAGGTGGG + Intergenic
1008682606 6:53889818-53889840 CCTTAGGCAAATTTGAAGCTGGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1009764938 6:68060166-68060188 CTGGAGACAAACTTGGAGCGAGG + Intergenic
1009871622 6:69459682-69459704 CTTTACAAAAACTTGGAGATGGG - Intergenic
1014597038 6:123358292-123358314 CTTTAGCTAAACTGGGAGCTGGG + Intronic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1018347525 6:162917353-162917375 TTTTAGACAGAGTTAGAGATTGG - Intronic
1019434427 7:1014867-1014889 CTGTAGACAGAATTGGTGCTCGG - Intronic
1020712459 7:11624842-11624864 CTTTATACAGAATTGGAACTAGG + Intronic
1021897463 7:25250503-25250525 ATTTGGACAAAGTTGGAAGTAGG + Intergenic
1023317462 7:38954492-38954514 CTTTAGACAGAGTTTTGGCTAGG - Intergenic
1023813859 7:43933443-43933465 CTTTAAAGAAACTTGGGGCTGGG + Intronic
1027441737 7:78226448-78226470 CTTGAGACCAATTTGGAGTTGGG + Intronic
1027781397 7:82524883-82524905 CTATAGAGAAAATTGGAGATTGG + Intergenic
1027928238 7:84496082-84496104 CTTTAAAAAAAGTTGCTGCTGGG + Intergenic
1029364021 7:100105955-100105977 CTTTAGATAAACCTGGAGCCTGG - Exonic
1029926523 7:104325221-104325243 AGTTAGACAAAGATGGTGCTAGG + Intergenic
1031313208 7:120225667-120225689 TTGTAGACATAGTTGGACCTAGG - Intergenic
1031974925 7:128087546-128087568 CTAGAGACAAAGGTGGTGCTGGG + Intronic
1031982088 7:128134703-128134725 ATTTAATCAAAGTTGGAGTTTGG + Intergenic
1033546659 7:142407249-142407271 GCTTAGACAGAGTGGGAGCTGGG - Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034502027 7:151456837-151456859 TTTGAGCCAAAGCTGGAGCTGGG + Intergenic
1041174564 8:55181076-55181098 CTCGAGACATAGTAGGAGCTTGG - Intronic
1041653294 8:60322518-60322540 CTGTAGACAAAGTGTGGGCTTGG + Intergenic
1045356340 8:101392447-101392469 CTTTAGACAAAGTTCCATGTGGG - Intergenic
1045645595 8:104294028-104294050 CTTGTAACAAAGTAGGAGCTTGG - Intergenic
1047631999 8:126718126-126718148 CTTTATAGAAAGTTTGAGTTAGG + Intergenic
1050987547 9:12102232-12102254 TTTTAGACAGGGCTGGAGCTGGG + Intergenic
1051227759 9:14920298-14920320 CTTTTGAGAAAGCTGGAGTTAGG - Intergenic
1054949867 9:70837911-70837933 CATTAGAGACAGTTGGATCTTGG + Intronic
1055437068 9:76302343-76302365 CATTAGAAAAAGTTGGAGACAGG + Intronic
1056084603 9:83133591-83133613 GTCTAGTCAAAGTTAGAGCTAGG + Intergenic
1056891570 9:90498890-90498912 ATTAAGAAAAACTTGGAGCTGGG - Intergenic
1060679769 9:125551895-125551917 CTTTAGACAAAGTAGGACAAGGG - Intronic
1190299841 X:49050674-49050696 TTTAAGACAAGGTTGGGGCTGGG + Intergenic
1197530278 X:127615602-127615624 CTTTAAACAAAATTGGAATTGGG + Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic