ID: 1094336788

View in Genome Browser
Species Human (GRCh38)
Location 12:29366496-29366518
Sequence GGTCATAGTAGAATACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094336788 Original CRISPR GGTCATAGTAGAATACAAAC AGG Intronic
909117331 1:71554690-71554712 GGACATTCTAGAATAAAAACTGG + Intronic
909735524 1:78955993-78956015 AGTCATATTAGAATATAATCTGG - Intronic
910031417 1:82729541-82729563 GTTCAAAGAAGAATAAAAACTGG + Intergenic
913247441 1:116882461-116882483 GGTAAAAGAAGAAGACAAACTGG + Intergenic
915991630 1:160523147-160523169 GGCCAAAGCAGAAGACAAACAGG + Exonic
917901567 1:179547981-179548003 GATCATAGTAGAGCAAAAACAGG - Intronic
919533372 1:198754197-198754219 GGTGATATTAGAATAAAAACAGG - Intronic
921860114 1:220034083-220034105 GGTTAGAGCAGAATACAAACAGG + Intronic
922915722 1:229255986-229256008 GGTCACAGAAGGATTCAAACAGG + Intergenic
1069181248 10:65361864-65361886 GGTAAGAGTAGAATACACAATGG - Intergenic
1070745430 10:78930947-78930969 GGTCAAAGTAGAAAAGAAATTGG - Intergenic
1072970664 10:100014550-100014572 GATCAGATTAGAAAACAAACAGG + Intergenic
1077983073 11:7321414-7321436 CTTCATAGTCGAATACAAATGGG + Intronic
1080318161 11:30973349-30973371 AGTCATAGTGGAAGACAAATAGG - Intronic
1082883621 11:58061914-58061936 GCTCATATTAGTATACGAACTGG - Intronic
1086167168 11:83792170-83792192 GTTCATAGTAGCAGAAAAACTGG - Intronic
1087636090 11:100703028-100703050 GCTCTTAGTAAAATGCAAACTGG - Intronic
1088610540 11:111572156-111572178 GGTCAGAGTAGGATAGAAAATGG - Intergenic
1090114976 11:123959898-123959920 GATCATAGTACAATAAAAATAGG - Intergenic
1091118393 11:133036579-133036601 GGTCATTGTATAATACAACAGGG - Intronic
1091357658 11:134950099-134950121 GGTCATATTAGAAAGCAGACGGG + Intergenic
1094336788 12:29366496-29366518 GGTCATAGTAGAATACAAACAGG + Intronic
1095895745 12:47278829-47278851 GGTCAAAGTAAAGTACAAAGAGG + Intergenic
1097725029 12:63065590-63065612 AGTCATGGTGTAATACAAACTGG + Intergenic
1098454226 12:70653936-70653958 AAACATAGTAGAAAACAAACAGG + Intronic
1100598749 12:96094097-96094119 GGATATAGTAGAAGACAAACAGG + Intergenic
1101448276 12:104753964-104753986 GGTCATAATAACATGCAAACTGG + Intronic
1105046606 12:133008909-133008931 GGTCATAGTGGAAGGCAAAGGGG + Intronic
1106109851 13:26767251-26767273 GGTCCTATTAGATTATAAACAGG - Intergenic
1106496659 13:30284660-30284682 GGTCTTAGAAGATTACAAATTGG - Intronic
1106899363 13:34338795-34338817 GGTCAAAGTAGGATACCAGCTGG - Intergenic
1111103701 13:83618688-83618710 AGTCACAGTACAATACAAATAGG - Intergenic
1114185594 14:20399357-20399379 GGTGATATTAGAAAATAAACTGG + Intronic
1114743154 14:25118971-25118993 GATCAAAGCAGAAAACAAACTGG - Intergenic
1116638932 14:47436099-47436121 GGTTATAGTTGTCTACAAACTGG + Intronic
1116660948 14:47709651-47709673 GGACATAGTATATTAGAAACTGG + Intergenic
1120316566 14:82901775-82901797 GGTCAGGGAAGAATACAAAGAGG + Intergenic
1120814723 14:88843628-88843650 GGTTTTAACAGAATACAAACTGG - Intronic
1124584562 15:30992531-30992553 GGGCAGAGTGGAATTCAAACAGG - Intergenic
1132324489 15:100957027-100957049 GGTCATAGAAGAAATCAAAAAGG - Intronic
1140464540 16:75169711-75169733 AGTCATAAGAGAATACATACTGG + Exonic
1149073545 17:52572588-52572610 GGTCAAAGGAGAGAACAAACAGG + Intergenic
1152415915 17:80161769-80161791 GGTCAAAGCAGGATGCAAACTGG - Intergenic
1153387415 18:4512796-4512818 GCTCATACTAGAATAAAAAATGG + Intergenic
1154497251 18:14971054-14971076 GGTCATATTAGAAAGCAGACAGG - Intergenic
1158215160 18:55093223-55093245 AGTCATAGTATAATAAAAATGGG + Intergenic
1158595765 18:58814535-58814557 GGTCATAGTGGAAGGCAAAGGGG - Intergenic
1162787036 19:13041817-13041839 CGACATAGTAGAATACACAATGG - Intronic
1165576064 19:36819595-36819617 GGTCATAAGAGAATTCATACCGG - Exonic
1165673407 19:37699217-37699239 GGTCATAAAAGAATTCATACTGG - Exonic
1167919029 19:52766863-52766885 CGTCATCGTAGAATTCATACTGG - Exonic
1168002131 19:53456458-53456480 GGACATAGGAGAATTCATACTGG + Exonic
1168002155 19:53456789-53456811 GGTCATCATAGAATTCATACTGG + Exonic
927395039 2:22639897-22639919 GGTCAAAGATGAAGACAAACAGG + Intergenic
928015333 2:27651024-27651046 GTTCAGAGTACAATACAAACTGG - Exonic
931209722 2:60180956-60180978 GGCTAGAGTAGAATATAAACTGG - Intergenic
932162199 2:69471139-69471161 GGGCAGAGTAGAATACTCACAGG + Exonic
932355692 2:71066868-71066890 CGTCAATGTAGAATACACACAGG - Intronic
936496153 2:113023212-113023234 GGACATAGTAGTAAACAAAAAGG - Intronic
939989935 2:148868079-148868101 AGTCAGTGTAAAATACAAACAGG - Intergenic
943343439 2:186709038-186709060 AGTCATAGTAGAAGGCAAAGAGG + Intronic
1174980230 20:55385831-55385853 GATCAAGGTAGAATACAAACTGG - Intergenic
1177860715 21:26450271-26450293 GGCCATAGTAGAATGTAAATTGG - Intergenic
1182898229 22:33876037-33876059 CGTCATAGAAGAAAACATACAGG + Intronic
949637101 3:5995062-5995084 GGGCTCAGTAGAATGCAAACAGG + Intergenic
951257014 3:20461630-20461652 GGGCAGAGTGGAATACAAATAGG + Intergenic
952291304 3:32018829-32018851 GGAAATAATTGAATACAAACAGG + Intronic
953617023 3:44500229-44500251 GGTCATCGGAGAATCCACACTGG - Exonic
954485512 3:50847306-50847328 GGTCACAATGGAATAAAAACAGG - Intronic
956203497 3:66731879-66731901 TGACACAGTAGAATACAAAGAGG - Intergenic
958962579 3:100523956-100523978 GGTCATAGTAGAATTCTAATGGG + Intronic
959449219 3:106479339-106479361 AGACATAAGAGAATACAAACAGG - Intergenic
961985774 3:131132391-131132413 GGTAATAATAGATTACAAACTGG + Intronic
963865251 3:150353784-150353806 GGTCATGGTAGAAAACAGAGAGG - Intergenic
968241412 3:197090329-197090351 GGTGATATTAGTATATAAACTGG - Intronic
976878197 4:89883696-89883718 GGACATAGTTGAAAACAAATTGG - Intronic
978705157 4:111699415-111699437 GGACATAGTAGAGAAAAAACTGG + Intergenic
980321580 4:131286399-131286421 AGTAATAGTAGAATTGAAACAGG - Intergenic
982398544 4:154940311-154940333 GGTCACAGTGGAATACAGCCTGG - Intergenic
982713554 4:158782988-158783010 GATCAAAGTCCAATACAAACTGG - Intronic
983647380 4:170005534-170005556 TGTCATAATAAAATATAAACAGG - Intronic
985190568 4:187368033-187368055 GGCCATAATAGAATACGGACAGG - Intergenic
988924648 5:35977586-35977608 TGTCATAGCAGAAGACAAAGGGG - Intronic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
989511511 5:42293086-42293108 GCTCTGAGTAGAATAAAAACTGG + Intergenic
991678522 5:69113797-69113819 AGTAATAGAAGAATAAAAACTGG - Intronic
993193960 5:84716513-84716535 GGTCACAGTGGAATATTAACTGG + Intergenic
994322198 5:98406757-98406779 GATCAGAGTAGAATAAAATCAGG - Intergenic
995727413 5:115195991-115196013 AGTCATAGGAGATTGCAAACTGG - Intergenic
996372820 5:122771364-122771386 GGCCATAGTAGAACAAAGACTGG - Intergenic
1009268225 6:61584433-61584455 GGTCATATAATAATACAAATAGG - Intergenic
1010179563 6:73069867-73069889 TGTGGTAGTAGAATACAAAGTGG + Intronic
1011758115 6:90526464-90526486 GGTCAAAGAAGAAAACAAAAGGG + Intronic
1014333465 6:120100801-120100823 GGTCAAAGTAGAATGCACAATGG + Intergenic
1018044880 6:159956968-159956990 GGCCATATTAGTATAGAAACAGG - Intergenic
1018329828 6:162715235-162715257 GGACATGGAAGAAGACAAACCGG + Intronic
1021090268 7:16474625-16474647 GGTTATATTAGAACACAAGCAGG + Intronic
1021209101 7:17823126-17823148 GCTCATAGTAGCATAAAGACTGG - Intronic
1021427566 7:20519825-20519847 GGACACACTAGAATACACACAGG + Intergenic
1021986158 7:26100452-26100474 GGGCAGAGTAGAAAACAAAAGGG - Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024131924 7:46361884-46361906 GGACACAGTATAATTCAAACTGG - Intergenic
1030008051 7:105137769-105137791 GGGCATAGTAGAAGAAAGACTGG - Intronic
1033501048 7:141950091-141950113 GGTCATAGTGGAACTCAGACTGG - Intronic
1034009409 7:147512041-147512063 AGTCTTAGTAAGATACAAACTGG + Intronic
1034076239 7:148233982-148234004 AATCATAGTAGAAGACAAAGGGG - Intronic
1036425313 8:8640321-8640343 GGTCATAATAAAAAATAAACAGG + Intergenic
1042014854 8:64297188-64297210 GGTCTTAGCAGAATAGAAATAGG - Intergenic
1043868580 8:85403462-85403484 TGTCATAATAGAACTCAAACTGG - Intronic
1048679235 8:136821124-136821146 ACTCATAGTACAATAAAAACTGG - Intergenic
1050692312 9:8241787-8241809 GGTGATAGTTTATTACAAACAGG - Intergenic
1050983583 9:12052999-12053021 GGTCAAAAAAGAATTCAAACGGG - Intergenic
1052011517 9:23415711-23415733 GGACATAGTACAAGACAGACTGG - Intergenic
1054859980 9:69940733-69940755 GGTCATAGAAGAAATCAAAGAGG + Intergenic
1054966337 9:71031626-71031648 GGTCTTAGTGGAATATAAATTGG - Intronic
1059813366 9:117882404-117882426 AGTCATGGTGGAATACAAAGGGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1189011947 X:37054423-37054445 GCTCATGGCAGAAGACAAACTGG - Intergenic
1189036759 X:37501862-37501884 GCTCATGGCAGAAGACAAACTGG + Intronic
1192326393 X:70135730-70135752 GGTGATGGTAGAACACAAAGAGG + Intronic
1198099065 X:133408205-133408227 AGACATACTAAAATACAAACAGG - Intronic
1201412059 Y:13709228-13709250 GGTTAAAGAAGAATATAAACTGG + Intergenic