ID: 1094338962

View in Genome Browser
Species Human (GRCh38)
Location 12:29389521-29389543
Sequence TCTCCCCGACGGGACCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094338955_1094338962 8 Left 1094338955 12:29389490-29389512 CCCACCTGGATGACTGATGGCGG No data
Right 1094338962 12:29389521-29389543 TCTCCCCGACGGGACCCCGCCGG No data
1094338959_1094338962 4 Left 1094338959 12:29389494-29389516 CCTGGATGACTGATGGCGGCGGC No data
Right 1094338962 12:29389521-29389543 TCTCCCCGACGGGACCCCGCCGG No data
1094338957_1094338962 7 Left 1094338957 12:29389491-29389513 CCACCTGGATGACTGATGGCGGC No data
Right 1094338962 12:29389521-29389543 TCTCCCCGACGGGACCCCGCCGG No data
1094338952_1094338962 12 Left 1094338952 12:29389486-29389508 CCACCCCACCTGGATGACTGATG No data
Right 1094338962 12:29389521-29389543 TCTCCCCGACGGGACCCCGCCGG No data
1094338949_1094338962 22 Left 1094338949 12:29389476-29389498 CCTCTCTTTCCCACCCCACCTGG No data
Right 1094338962 12:29389521-29389543 TCTCCCCGACGGGACCCCGCCGG No data
1094338954_1094338962 9 Left 1094338954 12:29389489-29389511 CCCCACCTGGATGACTGATGGCG No data
Right 1094338962 12:29389521-29389543 TCTCCCCGACGGGACCCCGCCGG No data
1094338951_1094338962 13 Left 1094338951 12:29389485-29389507 CCCACCCCACCTGGATGACTGAT No data
Right 1094338962 12:29389521-29389543 TCTCCCCGACGGGACCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094338962 Original CRISPR TCTCCCCGACGGGACCCCGC CGG Intergenic
No off target data available for this crispr