ID: 1094339803

View in Genome Browser
Species Human (GRCh38)
Location 12:29398392-29398414
Sequence CACTACTTAATGGTGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094339798_1094339803 -10 Left 1094339798 12:29398379-29398401 CCCAAAGTTATAACACTACTTAA No data
Right 1094339803 12:29398392-29398414 CACTACTTAATGGTGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094339803 Original CRISPR CACTACTTAATGGTGGAACT GGG Intergenic
No off target data available for this crispr