ID: 1094344842

View in Genome Browser
Species Human (GRCh38)
Location 12:29456042-29456064
Sequence CTAGTATTCCAATTTTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 417}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094344842 Original CRISPR CTAGTATTCCAATTTTATTT TGG Intronic
901553670 1:10014933-10014955 CCAGTAAGCCAATTTAATTTGGG - Intronic
905738393 1:40347946-40347968 CTATTTTTTCAAATTTATTTTGG + Intronic
906005503 1:42466026-42466048 AAAGTATACTAATTTTATTTGGG + Intronic
906260600 1:44385715-44385737 CAAGGATGCCAATTTTCTTTTGG + Intergenic
908095191 1:60730165-60730187 CTAGTTTTCCAGATTTACTTTGG - Intergenic
908628189 1:66071228-66071250 TTAGGTTTACAATTTTATTTTGG + Intronic
908996137 1:70157507-70157529 GTATTGGTCCAATTTTATTTGGG - Intronic
909071179 1:70995288-70995310 CTACCATTCCAATTTTTTTCTGG - Intronic
909523520 1:76596693-76596715 ATATTATTTCAATTTTATTATGG - Intronic
910358054 1:86383343-86383365 CTAGTATTCCAAATTATTTTTGG + Intronic
911676144 1:100660269-100660291 TTACTATTCTAATTTTCTTTTGG - Intergenic
913234932 1:116771980-116772002 CTAGTATTAGACTATTATTTAGG - Intergenic
914455065 1:147828675-147828697 CTTGTTTTCCAATTTTGCTTAGG + Intergenic
915521266 1:156445813-156445835 CTAGGTTTCCATTCTTATTTTGG - Intergenic
915750226 1:158200263-158200285 CTAGTATTATAAATATATTTGGG + Intergenic
915783082 1:158576061-158576083 CTAGTATTATAAATTTATTTTGG - Intergenic
917644361 1:177015575-177015597 CTACAATTCCACATTTATTTAGG + Intronic
917663384 1:177199659-177199681 CTAATTTTAAAATTTTATTTAGG + Intronic
918012407 1:180600116-180600138 CTATACTTCCAATTTGATTTTGG + Intergenic
918437510 1:184531600-184531622 TTAGTTTTCCATTTTTCTTTTGG + Intronic
918802103 1:188985599-188985621 CTAGTATTCCAATCAAATGTAGG + Intergenic
919109257 1:193197398-193197420 TTATTAGTCCAACTTTATTTTGG + Intronic
919329354 1:196149773-196149795 ATAGCTTTCCATTTTTATTTAGG - Intergenic
919529956 1:198704853-198704875 TTAGTTTTCAACTTTTATTTTGG - Intronic
920567442 1:206986047-206986069 CTAGGCTTCCATTTTTATTTTGG - Intergenic
920905245 1:210157898-210157920 CAAGCTTTCCAATGTTATTTGGG - Intronic
921691262 1:218153303-218153325 TTTGTATTCCAATTTCTTTTCGG - Intergenic
921717608 1:218434411-218434433 CTAGTTCTTCACTTTTATTTGGG - Exonic
922604151 1:226878754-226878776 CTAGTATGACAGTTTTGTTTTGG - Intronic
924392608 1:243579935-243579957 CTAGTTTTTTAATTTTATATTGG - Intronic
1064862337 10:19840815-19840837 ATATAATTTCAATTTTATTTTGG + Intronic
1065268562 10:24002647-24002669 CTATTTTTTAAATTTTATTTTGG + Intronic
1066695782 10:38076514-38076536 CTTGTACTCCCATTGTATTTTGG - Intergenic
1066762948 10:38773898-38773920 CTGTTATTTCAATTATATTTTGG - Intergenic
1066958627 10:42198533-42198555 CTGTTATTTCAATTATATTTTGG + Intergenic
1067255645 10:44636222-44636244 CTGGTATTCAAATTCTGTTTAGG + Intergenic
1068156703 10:53207927-53207949 TAAGGATTCCAATTATATTTGGG - Intergenic
1068704714 10:60061891-60061913 CTAGTATTCCATTTTTAAACTGG - Intronic
1069000330 10:63255823-63255845 CTAGAATTAGAATTTAATTTTGG - Intronic
1069308984 10:67009598-67009620 CTAATCTTCCAATGTTTTTTGGG + Intronic
1071575640 10:86724007-86724029 CTAGTATTCCAATTTTAAAGGGG - Intronic
1072579231 10:96725500-96725522 ACAGAATTCCAATTTTATTTGGG + Intergenic
1074677741 10:115871079-115871101 CTAGGATCCCAATAATATTTCGG + Intronic
1074892243 10:117745380-117745402 CTTGTATTCCGATTGTATTAAGG - Intergenic
1075234840 10:120718211-120718233 CTAGTTTTCCAGGTTTAGTTGGG - Intergenic
1075805067 10:125181714-125181736 CTAGTTTTTCTAGTTTATTTGGG + Intergenic
1076255514 10:129021563-129021585 CTAGTCTTGTAATGTTATTTTGG + Intergenic
1077379964 11:2227406-2227428 ATATAATTTCAATTTTATTTTGG - Intergenic
1077814482 11:5672604-5672626 ATAGTATTTCCATTTTGTTTAGG - Intronic
1077852397 11:6085603-6085625 CTAGTAACCCAATATAATTTGGG - Intergenic
1077875477 11:6301439-6301461 CTTCTATTCCAACTTTATTAGGG + Intergenic
1077958275 11:7044975-7044997 CTATTATTTCCATTTTACTTAGG + Intronic
1078244685 11:9563433-9563455 ATAGCCTTCCAAGTTTATTTAGG + Intergenic
1078970856 11:16409510-16409532 CTAGTGTGTCTATTTTATTTTGG - Intronic
1079049541 11:17141515-17141537 CTAGTTTTCCAACATTATATGGG - Intronic
1079530152 11:21442544-21442566 CAAGTATTTCAATTAAATTTAGG + Intronic
1079561108 11:21820941-21820963 CTAGTATTTCAATTATACATAGG - Intergenic
1079656860 11:22995602-22995624 GTGGTATTCCCATTTTCTTTAGG + Intergenic
1079769810 11:24444946-24444968 CCTGTACTCCCATTTTATTTTGG + Intergenic
1079869470 11:25779738-25779760 CATGTATTCTAATTTTATATGGG + Intergenic
1081504335 11:43699645-43699667 CTTGTGTTCCTATTTTAGTTTGG + Intronic
1082666858 11:55985340-55985362 CTATTAATATAATTTTATTTTGG + Intergenic
1082985824 11:59170614-59170636 CCAGTATTCAAAATTTAGTTGGG - Intergenic
1084744630 11:71161068-71161090 CTAGTTTTTCAGTTTTACTTTGG - Intronic
1084862044 11:72025411-72025433 CTAGTATTCTTTTTTTTTTTTGG - Intronic
1085161618 11:74352916-74352938 CAAGGATGCCATTTTTATTTGGG - Intronic
1087359870 11:97144730-97144752 CTAGGATTTCACTTTTATTCAGG + Intergenic
1087602353 11:100332764-100332786 CTTGTATGCCAATTTTGTTGAGG - Intronic
1087807860 11:102574977-102574999 CCATTATTCCAATTTTATAAAGG + Intergenic
1088043863 11:105423425-105423447 CTCTTTTTCCAACTTTATTTAGG + Intergenic
1089873649 11:121698975-121698997 CTATTATTCCCATTTTGTTGAGG - Intergenic
1091044235 11:132311729-132311751 CTATTATTCCAATTCTTTATTGG + Intronic
1091757668 12:3065467-3065489 CTAGTTTTTCAAGTTTACTTTGG - Intergenic
1092596516 12:10011446-10011468 CTAATATTCGAATATTATTGTGG - Intronic
1092682972 12:11008351-11008373 CCAGTTTTCCAGTTTTGTTTTGG - Intronic
1092984204 12:13829636-13829658 AGAGGATTCCAATTTTAATTTGG - Intronic
1093238996 12:16645625-16645647 GTAGAATTCCATTTTGATTTGGG + Intergenic
1093539995 12:20270448-20270470 GTAGAATTCATATTTTATTTCGG + Intergenic
1093585019 12:20824828-20824850 CTAATTTTACAATTTAATTTTGG + Intronic
1093987432 12:25551948-25551970 CTAGCATTTCAATGTTACTTTGG + Intronic
1094344842 12:29456042-29456064 CTAGTATTCCAATTTTATTTTGG + Intronic
1094528259 12:31247734-31247756 ATAGTTTTAAAATTTTATTTAGG - Intergenic
1095162452 12:38933976-38933998 GTGGTATTCCCATTTTCTTTAGG + Intergenic
1095206001 12:39442098-39442120 CTAGTATTGAAATTATATTTCGG - Intronic
1097617805 12:61904559-61904581 GTATTATTCCCATTTTATTTAGG - Intronic
1098338481 12:69427522-69427544 CTTGTACTCCATTTTTATCTTGG - Intergenic
1098444918 12:70556544-70556566 CTGGTATTCCCATTTTGTGTAGG - Intronic
1098593280 12:72239769-72239791 ATAGTATCTCAGTTTTATTTAGG - Intronic
1098942786 12:76557169-76557191 CTAGTTTTCTAATATTAATTTGG - Intronic
1099063467 12:77943005-77943027 CTATCATTCCAATTTGATTCTGG + Intronic
1099460602 12:82916488-82916510 ATAGTGTTCGATTTTTATTTTGG - Intronic
1099628529 12:85109447-85109469 CTAATAGTACAATGTTATTTAGG + Intronic
1099644334 12:85332072-85332094 CTAGCATTCTAATTTTAAATAGG - Intergenic
1099741935 12:86648987-86649009 CCATTATAACAATTTTATTTAGG + Intronic
1099882109 12:88479763-88479785 ATAGCTTTTCAATTTTATTTCGG - Intergenic
1100295979 12:93261730-93261752 CTAGTATTTTAATTCTACTTGGG + Intergenic
1101458795 12:104867179-104867201 CTAGTTTTTCTATTTCATTTTGG - Intronic
1101496615 12:105260515-105260537 CCATTATACCACTTTTATTTAGG - Intronic
1103125530 12:118418979-118419001 CCAGTATTCAATTATTATTTTGG + Intergenic
1107021360 13:35755825-35755847 CTAGTTTTCCAAGTTAACTTTGG + Intergenic
1107279618 13:38718901-38718923 CTAGTATTCTCATTTTACTTAGG + Intronic
1107693502 13:42976822-42976844 CCACAATTACAATTTTATTTGGG + Intronic
1108637912 13:52354207-52354229 CTACTTTTCCCATTTTACTTGGG + Intergenic
1108696310 13:52905510-52905532 GTAGTCTTTCAGTTTTATTTTGG + Intergenic
1108900053 13:55391048-55391070 CTAGAATAGAAATTTTATTTTGG + Intergenic
1108906451 13:55480375-55480397 ATAGTATTCCAATTTTCTCAGGG + Intergenic
1109535116 13:63706515-63706537 CTGGTATTCTAATATTACTTGGG - Intergenic
1109576900 13:64271545-64271567 GTAAAATTCTAATTTTATTTAGG - Intergenic
1109883751 13:68515007-68515029 CTGATATTCCAAAATTATTTGGG - Intergenic
1111369568 13:87299225-87299247 CTAACATTCCAATTTTCTTAAGG + Intergenic
1111784814 13:92772950-92772972 CTAGTTTTCTTATTATATTTTGG - Intronic
1112015829 13:95330675-95330697 CTGGTCTTCCAATTTTATTCTGG - Intergenic
1113343782 13:109453383-109453405 TTGGTCTTCCAATTTTACTTTGG - Intergenic
1115252853 14:31367717-31367739 CTTCTATTGAAATTTTATTTGGG - Intronic
1115464212 14:33696911-33696933 TTGGTATTCCAAGTTGATTTGGG - Intronic
1115665351 14:35539204-35539226 CTAATTGTCCAATTGTATTTTGG + Exonic
1115844779 14:37516878-37516900 CTTGTATTTTAAGTTTATTTTGG - Intronic
1116139009 14:40965060-40965082 TTTATATTCCAATTTTGTTTAGG + Intergenic
1116378324 14:44231993-44232015 CCAGTATTCCCATTGTATCTTGG - Intergenic
1116468812 14:45264095-45264117 CTAGTTTTTGTATTTTATTTTGG + Intergenic
1119273610 14:73332031-73332053 CTAGGATTTCAATTTTTTCTAGG + Intronic
1119966255 14:78919024-78919046 CTAGTTTACCAATTATATTTGGG - Intronic
1120268264 14:82277934-82277956 CTTGTACTCCCATTGTATTTTGG + Intergenic
1120963416 14:90146285-90146307 CTACCACTCCAGTTTTATTTTGG + Intronic
1121003603 14:90471431-90471453 CTAATATGCCAATGTTACTTGGG + Intergenic
1121558857 14:94859455-94859477 CTGATATTTTAATTTTATTTTGG - Intergenic
1121770068 14:96526496-96526518 CTAATTTTTTAATTTTATTTTGG + Intronic
1122095971 14:99372644-99372666 CTGATATTCCAATCTTACTTAGG + Intergenic
1125113877 15:36065943-36065965 TTACTATTCCACTTTTCTTTTGG - Intergenic
1125304456 15:38293894-38293916 CTAGTATTCATATTTGATGTAGG - Intronic
1126717541 15:51535858-51535880 CAAGTATTCACATTTTTTTTAGG + Intronic
1126748766 15:51854059-51854081 CTAGTTTTCCTATATTATCTCGG - Intronic
1127448728 15:59094510-59094532 CAATTATTCCAGTTTTGTTTTGG - Intronic
1127698384 15:61473688-61473710 CTATTACTCCAAGTTTATTATGG + Intergenic
1127887089 15:63211131-63211153 CTGGTCTTTCACTTTTATTTGGG - Intronic
1129571801 15:76694521-76694543 CTATTTTTCCAACTTTATTGAGG - Intronic
1131001038 15:88940527-88940549 CTAGTTTTTCACTTTCATTTTGG + Intergenic
1131745057 15:95438583-95438605 TTATTATTCCAATTTTATAGCGG - Intergenic
1132922766 16:2407484-2407506 ATAGTTTCTCAATTTTATTTTGG - Intergenic
1134251045 16:12574172-12574194 CTTGTATTAAAATTTTCTTTTGG + Exonic
1135270477 16:21065460-21065482 CTATTATTCATATTTTAATTAGG + Intronic
1135866289 16:26105491-26105513 CTTGTTTTCGACTTTTATTTCGG - Intronic
1137595935 16:49723861-49723883 CTAGATTTCCAGTTGTATTTGGG + Intronic
1138665485 16:58563870-58563892 CTAGTAGTCCAATTATACATTGG + Intronic
1139543157 16:67634007-67634029 CTATTATTCACATTTTATGTGGG - Intronic
1139892493 16:70262630-70262652 CTAATTGTCCAATTGTATTTTGG + Intronic
1140782372 16:78308318-78308340 CTAGTTTTTCAGGTTTATTTCGG - Intronic
1141004687 16:80340951-80340973 AAACTATTCCAATTTTGTTTAGG + Intergenic
1141475323 16:84269171-84269193 CTGGTTTTTCAATTTTATTAAGG - Intergenic
1144175703 17:12704900-12704922 CAAGTATTCTAATTCTAGTTTGG + Intronic
1144213639 17:13035742-13035764 CTAGATTTCCATTTTTATTAAGG - Intergenic
1146757567 17:35447184-35447206 TTAGGGTTTCAATTTTATTTAGG - Intronic
1148951849 17:51320234-51320256 CTAGTTTTTCAGGTTTATTTTGG + Intergenic
1149670146 17:58400554-58400576 CTATTATTCCCATTTTACTCAGG + Intronic
1149821702 17:59785948-59785970 CTAGTATTAAAACTTAATTTGGG - Intronic
1151112867 17:71700163-71700185 CTAGTACTCCATTTTTATATGGG + Intergenic
1153163540 18:2236814-2236836 TTAGTCTTCAAATTTTACTTAGG + Intergenic
1153446531 18:5178942-5178964 TTGGTATGCCAATTTTCTTTGGG + Intronic
1155397024 18:25397387-25397409 CCATTTTTACAATTTTATTTGGG - Intergenic
1155430336 18:25749003-25749025 TTAAAAGTCCAATTTTATTTTGG - Intergenic
1155674601 18:28414945-28414967 CTTGTATTACAATTGGATTTGGG + Intergenic
1155736140 18:29224740-29224762 ATAGTATTTGAATTTTACTTTGG - Intergenic
1156275488 18:35580280-35580302 CTAATAGTCCAATTTTAAATGGG - Intergenic
1156607456 18:38682872-38682894 ATATTATTCCAGTTTTAATTTGG - Intergenic
1157995147 18:52545909-52545931 CAACTTTTCCAATTTTATATTGG + Intronic
1158505044 18:58040223-58040245 CTAGTAATCCAATTTCTTTGGGG - Intergenic
1159318815 18:66818587-66818609 TTACTAATCAAATTTTATTTTGG + Intergenic
1159998051 18:74986404-74986426 GGAGTATTTAAATTTTATTTTGG - Intronic
1166187211 19:41148672-41148694 CTGGTATTTCAATTTTGTCTGGG - Intergenic
1167680674 19:50918269-50918291 CTAGCTTTTAAATTTTATTTAGG + Intergenic
1168428015 19:56255063-56255085 TTCTTATTACAATTTTATTTAGG + Intronic
926411631 2:12609278-12609300 CTAGGATGCCATTTTTACTTGGG - Intergenic
926686294 2:15700648-15700670 CAAATATTCCGATTTTATTCTGG + Intronic
928102356 2:28446563-28446585 CTAATTTTTCAATTTTTTTTAGG - Intergenic
930792516 2:55348979-55349001 CTAATGTTTCATTTTTATTTGGG - Intronic
930799735 2:55430550-55430572 GTAGTATATCAATTTTATTATGG + Intergenic
930923093 2:56781818-56781840 CTGTTATTGCAATTTTATTCAGG - Intergenic
931032268 2:58190855-58190877 CTAAAATTCAACTTTTATTTTGG + Intronic
931341001 2:61400683-61400705 CTAGTTTTTCAATTTTTTTGAGG - Intronic
931582409 2:63791357-63791379 TTAGTATTCCAATTCTTTATGGG + Intronic
931862397 2:66369742-66369764 CTAGTGTTGCAGCTTTATTTTGG - Intergenic
933024611 2:77240093-77240115 CTAGTAATTTAATTTCATTTTGG - Intronic
933065362 2:77786827-77786849 TTAGTATTTCAATTTCATTATGG + Intergenic
933096717 2:78191950-78191972 ATAGTAGTCCAATTTTTTTCAGG - Intergenic
933096944 2:78196748-78196770 ATGGTAGTACAATTTTATTTTGG - Intergenic
934306982 2:91834180-91834202 CTATTATTTCAATTATATTTTGG + Intergenic
934326274 2:92018562-92018584 CTATTATTTCAATTATATTTTGG - Intergenic
934464630 2:94249177-94249199 CTGTTATTTCAATTATATTTTGG - Intergenic
935634648 2:105240987-105241009 CTAGTATTATCATTTTGTTTTGG - Intergenic
936466070 2:112751818-112751840 ATAGTATTTAAATTTTATCTTGG - Intronic
936627201 2:114161163-114161185 ATAGTATTTCAATTTTGTTGGGG + Intergenic
937179633 2:119980552-119980574 CTAGTATTCCTATATTATACTGG + Exonic
939082830 2:137684153-137684175 CTATTTTTCAATTTTTATTTAGG - Intergenic
939767786 2:146273954-146273976 CTAGTACTCCAAAATTATTCAGG + Intergenic
940167049 2:150785446-150785468 CAGGTATTCTAATTTAATTTAGG + Intergenic
940606888 2:155936520-155936542 TTAGTATTCCATTATAATTTTGG + Intergenic
940785456 2:157976454-157976476 CTAATAATCCAATTTTAAATGGG - Intronic
941296804 2:163749032-163749054 CTAATTTTCGTATTTTATTTTGG + Intergenic
941925486 2:170890035-170890057 CTAGTTTTATAGTTTTATTTCGG + Intergenic
942764068 2:179433190-179433212 GTAGTATTCCCATTTTATAGAGG + Intergenic
943067704 2:183106040-183106062 ATGGTCTTCCAAGTTTATTTAGG + Intergenic
943306090 2:186264475-186264497 CTATTATTCCCATTGTATTTAGG - Intergenic
943999685 2:194817589-194817611 CTTGTATTCAAATTATTTTTTGG - Intergenic
946552225 2:220815079-220815101 CAAATATTACATTTTTATTTAGG - Intergenic
947276162 2:228395048-228395070 CTTGTATCCCCATTTTATCTAGG + Intergenic
1169646275 20:7813443-7813465 CTAATGTTCCAATTTTAATATGG - Intergenic
1170875443 20:20245643-20245665 CTATTATCCCTATTTTTTTTAGG - Intronic
1171235654 20:23522256-23522278 CTAGTGTTTCAGTTTTACTTTGG + Intergenic
1171962882 20:31507672-31507694 ATAATATTCCATTTTTATCTAGG + Intergenic
1173259298 20:41419198-41419220 CTAGTATGTAAATTTTAATTTGG + Intronic
1173323551 20:42011127-42011149 CTTGTTTTCTAATTTTTTTTTGG + Intergenic
1174689043 20:52484520-52484542 CCATTATTCCTATTTTAGTTTGG - Intergenic
1174958890 20:55133063-55133085 GTAGAATTCCTATGTTATTTTGG + Intergenic
1177709536 21:24754212-24754234 CTAATTTTCCCATTCTATTTTGG + Intergenic
1178257658 21:31069527-31069549 CTGGAATTCCAATTTTGTTCTGG + Intergenic
1178347027 21:31838475-31838497 ACAAAATTCCAATTTTATTTAGG - Intergenic
1178963970 21:37097539-37097561 CAAGTTTTCCCATTTCATTTTGG - Intronic
1180278536 22:10669464-10669486 CTGTTATTTCAATTATATTTTGG - Intergenic
1180585787 22:16888331-16888353 CTATTATTTCAATTATATTTTGG - Intergenic
1182155451 22:28067717-28067739 CTAGACTTCAAATTCTATTTGGG + Intronic
1185130668 22:49037036-49037058 ATACTATTCCAGTTTTCTTTGGG - Intergenic
949165622 3:937415-937437 CAAGTATGGCAATTTTATTATGG - Intergenic
949293490 3:2493660-2493682 ATAGAACACCAATTTTATTTTGG + Intronic
949354155 3:3159963-3159985 CTAGTATTAAAATTTTCTTGAGG - Intronic
949996883 3:9624789-9624811 ATAGAACTACAATTTTATTTTGG + Intergenic
951323281 3:21272277-21272299 CTAGAAATCCAACTTTATTTAGG - Intergenic
951864969 3:27298121-27298143 TTATTTTTCCATTTTTATTTAGG + Intronic
956635458 3:71359690-71359712 CTACAATTCCAAAATTATTTGGG - Intronic
957284346 3:78198243-78198265 CTGGTAGTCCAATTTCTTTTTGG + Intergenic
958525195 3:95248830-95248852 CTTTTTTTCCAATATTATTTTGG + Intergenic
958556781 3:95688572-95688594 CTAGTATTCTATTTTGATTTTGG + Intergenic
959049630 3:101512736-101512758 CCAATGTTCCAATTTCATTTCGG - Intronic
959136123 3:102423513-102423535 TTAATCTTACAATTTTATTTTGG + Intronic
961943974 3:130666730-130666752 CTAGAATTCCAATTAGATATAGG - Intronic
962237230 3:133716963-133716985 CTAGTTTCCTCATTTTATTTAGG + Intergenic
962767497 3:138579258-138579280 ATAGTGTTTCAAGTTTATTTAGG - Intronic
963304308 3:143633763-143633785 CTAGGATTTGAATTTTATTTAGG + Intronic
963573383 3:147026866-147026888 CTTGTATTCCAATTTTCCATGGG - Intergenic
964048470 3:152360712-152360734 CTAGTATTATAATTTTTGTTGGG - Intronic
964328058 3:155569319-155569341 CAAATATTCCATTTTTGTTTAGG + Intronic
965167407 3:165212783-165212805 GGACTATTGCAATTTTATTTAGG + Intergenic
965272531 3:166637537-166637559 TTCTTATTCCATTTTTATTTAGG + Intergenic
965693415 3:171381614-171381636 CAAAAATTCCAATTTTATTTGGG + Intronic
965866130 3:173206048-173206070 CTAGCATTCCAAATTTGTATTGG - Intergenic
966024266 3:175256802-175256824 AGAGTATGCCAATTTTATTAAGG - Intronic
966230881 3:177650492-177650514 CTTGTACTTCACTTTTATTTGGG + Intergenic
966272336 3:178122226-178122248 ACAGTGTTTCAATTTTATTTAGG - Intergenic
966494437 3:180563678-180563700 CTACTTTTCCGGTTTTATTTGGG + Intergenic
966791132 3:183670788-183670810 GTGGTATTACAATTTTATTGAGG + Intronic
967096735 3:186183394-186183416 CTTGTATTTCTATTTCATTTTGG - Intronic
967386217 3:188913602-188913624 CTTTTTTTCCAATTTTATTTTGG - Intergenic
969247145 4:5942662-5942684 CTCTTATCCCCATTTTATTTAGG + Intronic
970735751 4:19165567-19165589 CCAGTATCCCAGTTGTATTTGGG + Intergenic
970760121 4:19475653-19475675 CTAGTATTGCAATTTTTAATAGG + Intergenic
971626585 4:28928096-28928118 CTAGTATTTCAAAATTACTTTGG + Intergenic
973027409 4:45290100-45290122 TTAGTATTTCAATTTTTTTCTGG + Intergenic
973969179 4:56194090-56194112 CTAGTATTCCATTATTAGATGGG + Intronic
974410632 4:61537661-61537683 CTAGGCTTCCAACTGTATTTTGG + Intronic
974577905 4:63752159-63752181 GTTGAATTTCAATTTTATTTTGG - Intergenic
974977567 4:68909386-68909408 CTAATTTATCAATTTTATTTTGG + Intergenic
974987711 4:69050260-69050282 CTAATTTATCAATTTTATTTTGG - Intronic
975046881 4:69816314-69816336 GGAGTATTTCTATTTTATTTAGG + Intronic
975321709 4:73015830-73015852 AAATTATTCCAAGTTTATTTTGG + Intergenic
975946537 4:79712634-79712656 CTCATATTATAATTTTATTTTGG - Intergenic
975962591 4:79931024-79931046 CTAATATTACAATTCTATTTAGG - Intronic
977482646 4:97597856-97597878 CTAGGGTTCCAATACTATTTTGG - Intronic
978680340 4:111373501-111373523 CTAGTTTTTCAATGTTATTTAGG - Intergenic
979550030 4:121980094-121980116 CTTGTATTTCCATTTTCTTTTGG - Intergenic
980136800 4:128865786-128865808 ATATTATTCAAATTTAATTTTGG - Intronic
980310928 4:131127940-131127962 CTCAAATTCCAATTTGATTTCGG + Intergenic
980840225 4:138250479-138250501 ATAAAATTCCAAATTTATTTGGG - Intergenic
982493277 4:156056953-156056975 TTAGTTTTCCAATTCTTTTTGGG + Intergenic
987046220 5:14111495-14111517 ATGGTATTACAATTTTATTAAGG + Intergenic
987491078 5:18581061-18581083 CTATTATGCCCATTATATTTAGG + Intergenic
987910057 5:24130933-24130955 CTAGTTTTGCAATTTGATCTTGG + Intronic
988033918 5:25800829-25800851 CTACTATTCTAATTTAATTTGGG - Intergenic
988165339 5:27581941-27581963 TTAGTTTTCCATTTTTATTTGGG + Intergenic
988192271 5:27954606-27954628 TTAGGATTCCAAGTTTACTTTGG + Intergenic
988231061 5:28479917-28479939 ATAGTAATATAATTTTATTTTGG + Intergenic
988862348 5:35295929-35295951 CAAGTATTTCCCTTTTATTTGGG + Intergenic
989040393 5:37221681-37221703 AAATAATTCCAATTTTATTTGGG - Intronic
989699972 5:44252344-44252366 ATAGTTTTCCAACTTTATTGGGG + Intergenic
989774722 5:45190708-45190730 CTTGGATTCCAATTCTTTTTTGG + Intergenic
989805333 5:45596847-45596869 ATATTCTTCTAATTTTATTTTGG - Intronic
990005689 5:50941887-50941909 CTTCTATGCCAATTTTATTGAGG - Intergenic
990054420 5:51553490-51553512 TTAGTTCTGCAATTTTATTTTGG - Intergenic
991380994 5:66027155-66027177 ATAGTATTCCCATTTTATGTAGG + Intronic
992229263 5:74647665-74647687 CAAGTCTTCCAACTTTATTTGGG - Intronic
993021740 5:82600227-82600249 CTAACATTCTAATTTCATTTTGG + Intergenic
993263650 5:85694135-85694157 CTTGTATCCCCATTGTATTTTGG - Intergenic
993748509 5:91633486-91633508 CAATTATTCCTATTTAATTTGGG - Intergenic
993993413 5:94687915-94687937 AAAGTTTTCCAGTTTTATTTTGG + Intronic
994213096 5:97108019-97108041 CTATTATTCCCATTTTATAGAGG - Intronic
994544857 5:101152725-101152747 CATGTTTTCCAAATTTATTTTGG + Intergenic
994595614 5:101829827-101829849 CTTGTACTCAAATTTTAATTGGG + Intergenic
994904476 5:105820012-105820034 TTTGTTTTTCAATTTTATTTGGG + Intergenic
994924970 5:106103793-106103815 TTAGTATTCCTATTTGTTTTAGG - Intergenic
995233792 5:109801506-109801528 ATAGAAAGCCAATTTTATTTAGG - Intronic
995580287 5:113592596-113592618 TTATTAGTCCAATTTTATATAGG + Intronic
995597496 5:113763709-113763731 TTCTTATTCCAATTTAATTTTGG + Intergenic
995896882 5:117023369-117023391 GTAGAATTTCAATTTTATTTAGG + Intergenic
996005211 5:118412191-118412213 CAACCATACCAATTTTATTTTGG - Intergenic
996158816 5:120136767-120136789 CTATGATTCCTTTTTTATTTTGG - Intergenic
996239903 5:121184805-121184827 CTATTTTTCCAGTTTTATCTTGG + Intergenic
996300667 5:121980237-121980259 ATAGTATTACAATTTTCTATAGG - Intronic
996499030 5:124195928-124195950 TTCATATTCCAATTTTATTGTGG - Intergenic
997186126 5:131884062-131884084 CTAGACTTTCAAGTTTATTTAGG - Intronic
998032641 5:138884754-138884776 CTAGTTTTTCAAGTTTACTTTGG + Intronic
998244241 5:140483098-140483120 CTATTATTAGAATTATATTTAGG + Intronic
998607677 5:143651793-143651815 ATATTATTCCATTTTTATATAGG - Intergenic
999801732 5:155044756-155044778 CTAGTTTTTCAAGTTTACTTTGG - Intergenic
1000492404 5:161930633-161930655 CTAGTATTACACTAGTATTTAGG + Intergenic
1000615490 5:163421288-163421310 GTAGTATACAAATTTTAATTAGG - Intergenic
1003955414 6:11160718-11160740 CTAGTATTTCTACTTTGTTTTGG + Intergenic
1004818115 6:19334483-19334505 CTAGTAATCAAATTTTTTATTGG - Intergenic
1005184877 6:23154078-23154100 GAAGTATTTAAATTTTATTTTGG + Intergenic
1005469765 6:26151116-26151138 ATTGTATTCCAATGTTACTTAGG + Intergenic
1005907754 6:30279587-30279609 CTATTTGTCCAGTTTTATTTTGG + Intergenic
1007912709 6:45532044-45532066 GTAGTGTTCCCATTTTCTTTTGG + Intronic
1007980570 6:46152171-46152193 CTCTTACTCCAGTTTTATTTTGG + Intergenic
1008312764 6:49997067-49997089 CTTGTAATCAATTTTTATTTTGG - Intergenic
1008744880 6:54657682-54657704 ATACTTTTCCAAATTTATTTAGG - Intergenic
1008808067 6:55455943-55455965 TTAATATTCTAATTTTATTTGGG - Intronic
1008836881 6:55843621-55843643 TTATTATTCCAATTTTATGGTGG + Intronic
1009894059 6:69725120-69725142 CTAGTTATTTAATTTTATTTGGG - Intronic
1010177872 6:73050690-73050712 ATATCATTCCAAGTTTATTTAGG - Intronic
1010510985 6:76719344-76719366 CTATTAGTACATTTTTATTTTGG - Intergenic
1011230012 6:85150206-85150228 CTAGTTTTCCAGGTTAATTTTGG - Intergenic
1011325333 6:86144772-86144794 TTAGTATTCCAATTACATTGAGG + Intergenic
1011362680 6:86544960-86544982 CTTGTTTTCCAATGTTACTTAGG + Intergenic
1011759466 6:90545745-90545767 ATAGTACTCTGATTTTATTTAGG + Intronic
1012016692 6:93861284-93861306 CTAATGTTCCATTTTTATTATGG - Intergenic
1012039295 6:94184583-94184605 CCAGTATCCCAATTGTATATTGG - Intergenic
1012077967 6:94717797-94717819 CTAGCATTGGAATTTTGTTTAGG - Intergenic
1012106921 6:95173939-95173961 CTAGCAATTCAATTATATTTAGG + Intergenic
1012455740 6:99403109-99403131 ATAGTATTCTAATTTTTTTAGGG - Intronic
1013871007 6:114759763-114759785 CTAAAATTCAGATTTTATTTGGG - Intergenic
1014120298 6:117717237-117717259 CTAGGTTTTCAAATTTATTTGGG + Intergenic
1014271088 6:119336841-119336863 CTTGTATTTCAATTTTATACAGG - Intronic
1014493995 6:122097261-122097283 CCTGTATTCTAATTTTATTTGGG + Intergenic
1015123244 6:129723733-129723755 TTAGTAATCACATTTTATTTAGG - Intergenic
1015712163 6:136154018-136154040 CTAGTATACCACTCCTATTTGGG + Intronic
1017461686 6:154656776-154656798 CTAGTTTTAAAATTTTTTTTTGG - Intergenic
1018241120 6:161775640-161775662 CTAGTTTTCCAATGTGTTTTAGG + Intronic
1021122427 7:16812019-16812041 CTATTATTCCCAGTTTATGTTGG + Intronic
1022361885 7:29668480-29668502 CTATTTTTGCAATTTTGTTTGGG + Intergenic
1022699508 7:32745255-32745277 CTATTTTTGCAATTTTGTTTAGG - Intergenic
1022759032 7:33327081-33327103 CTAGACTTTCAAATTTATTTGGG + Intronic
1023189778 7:37567969-37567991 TTAGAATTTCTATTTTATTTAGG + Intergenic
1023245453 7:38198584-38198606 CTATTATTCCAACATTCTTTTGG + Intronic
1024812092 7:53223782-53223804 ATAGTTTTCCATTTTAATTTTGG - Intergenic
1025748156 7:64264975-64264997 TTATTTTTCTAATTTTATTTAGG + Intronic
1026237094 7:68536043-68536065 CTAGTATTATCATTTTCTTTAGG - Intergenic
1026726936 7:72877334-72877356 TTAGTTTTCCATGTTTATTTTGG - Intergenic
1027116897 7:75488285-75488307 TTAGTTTTCCATGTTTATTTTGG + Intergenic
1027274907 7:76547313-76547335 TTAGTTTTCCATGTTTATTTTGG - Intergenic
1027515227 7:79134144-79134166 TCAGTATTGCAATTTTAATTTGG - Intronic
1028004056 7:85539908-85539930 CTAGAATTTCTAGTTTATTTGGG + Intergenic
1028031682 7:85923000-85923022 ATAGTACTCTAATTTAATTTTGG + Intergenic
1028268977 7:88763488-88763510 CAATTATTCCCATTTTAATTAGG - Intronic
1028389446 7:90297316-90297338 CTAGTTTTTCAAGTTTACTTTGG + Intronic
1028579777 7:92396133-92396155 CAAGTATTCCTAATTTATCTAGG + Intronic
1029051216 7:97690059-97690081 CTAGTATTCAAATATTTTTTGGG - Intergenic
1029720604 7:102361776-102361798 TTAGTTTTCCATGTTTATTTTGG - Intergenic
1029950015 7:104573895-104573917 ATAGTATTCCACTTTAATTTTGG + Intronic
1030492611 7:110256630-110256652 CTAATATACCAATAATATTTGGG + Intergenic
1030940501 7:115641135-115641157 TTATTATTTCAATTTTGTTTAGG + Intergenic
1031259299 7:119497047-119497069 CCAGTTTTTCAATTGTATTTTGG - Intergenic
1031345712 7:120663415-120663437 ATAGTCTTCCAATTTTATGATGG + Intronic
1032107333 7:129044478-129044500 CTTGTTTTCTAATTTCATTTTGG + Intronic
1032218868 7:129978822-129978844 CTGGGATTCCAATTTTGTGTGGG + Intergenic
1032271265 7:130409402-130409424 CAAGTACTCCAATTTTAACTGGG - Intronic
1032623536 7:133563259-133563281 TTAAAATTCCATTTTTATTTGGG - Intronic
1032648314 7:133850534-133850556 CTAATATTCCATTTCTCTTTGGG + Intronic
1032710306 7:134455294-134455316 CTGATATTACAATTTTATTTTGG + Intronic
1034373725 7:150625689-150625711 CTAGAATACCAATATGATTTTGG + Exonic
1038630379 8:29237282-29237304 CTACTATTGCATTTTTTTTTTGG - Intronic
1039763088 8:40599471-40599493 CAAGTTTTCCAATTTTATCTGGG - Intronic
1040985283 8:53287055-53287077 CTAGGATTCCTGTTTTATTCGGG - Intergenic
1041576561 8:59403284-59403306 CTTGTATTCCAAGTTTTTTGAGG - Intergenic
1041805320 8:61843010-61843032 CTAGTTTTCCAGTTTTACTCTGG - Intergenic
1042011558 8:64251347-64251369 CTATTATTCTCTTTTTATTTGGG + Intergenic
1042024854 8:64412148-64412170 CTAGTATTCTTATTTTCCTTTGG + Intergenic
1042037900 8:64556991-64557013 CTAGTAATATATTTTTATTTTGG + Intergenic
1042901667 8:73734851-73734873 TTAGTACTACATTTTTATTTGGG - Intronic
1043061246 8:75506961-75506983 TGAGCATTGCAATTTTATTTGGG + Intronic
1043168086 8:76929723-76929745 CTTCTTTTTCAATTTTATTTTGG + Intergenic
1043315284 8:78913565-78913587 ATAGTTTTGCAATTTTCTTTGGG - Intergenic
1043467990 8:80533022-80533044 ATAGGATTCCAATTTATTTTAGG - Intergenic
1044071375 8:87764280-87764302 GTAGGATATCAATTTTATTTGGG + Intergenic
1044083291 8:87911467-87911489 TTATTTTTCCCATTTTATTTTGG - Intergenic
1044522629 8:93216969-93216991 CTAGTGTTTCAGGTTTATTTTGG + Intergenic
1044563637 8:93639021-93639043 AAAGTTTTGCAATTTTATTTTGG - Intergenic
1044913017 8:97081892-97081914 TTAGTATTACTATTTTATTTAGG - Intronic
1044921543 8:97174707-97174729 TTAGGATTCAAATTCTATTTAGG + Intergenic
1045096946 8:98807556-98807578 CCAGTAATCAAATGTTATTTAGG + Intronic
1045174137 8:99702864-99702886 CTAGCATTACAAATCTATTTCGG - Intronic
1045829425 8:106440803-106440825 CTGGTATTTTAATTTTAATTTGG - Intronic
1046095753 8:109558538-109558560 ATAGTATTATAATTATATTTAGG - Intronic
1046121031 8:109847553-109847575 CTAATATACCCATTTTATCTAGG + Intergenic
1046187212 8:110736886-110736908 TTAGTATTTCAGTTTTATTGAGG + Intergenic
1047100846 8:121674330-121674352 CCAGAACTTCAATTTTATTTGGG + Intergenic
1047687760 8:127318080-127318102 ATTGTATTCCAATTTCTTTTTGG - Intergenic
1050228863 9:3494704-3494726 ATAGTTATCAAATTTTATTTTGG - Intronic
1050235556 9:3575660-3575682 CTTGTATTCCTAATTTACTTAGG - Intergenic
1050796859 9:9557188-9557210 CTAGTTTTTCAAGTTTAATTTGG - Intronic
1050919057 9:11176312-11176334 CTAGTAATCCCATTACATTTTGG + Intergenic
1050933580 9:11363443-11363465 TTAGTTTTCTAATTTTATTAGGG - Intergenic
1051162449 9:14223483-14223505 TTAGCATTCCAATTTTTTTTAGG + Intronic
1051470841 9:17439993-17440015 TTAATATTTCTATTTTATTTGGG - Intronic
1051503773 9:17805901-17805923 CCAGTATTTCACTTTGATTTGGG - Intergenic
1051754181 9:20377957-20377979 CCAGTATTCTAATTCTATTGAGG - Intronic
1052305556 9:27005386-27005408 ATTGTATTCTAACTTTATTTAGG + Intronic
1052522972 9:29573357-29573379 TTAGTAGTCCAAATATATTTTGG + Intergenic
1052732228 9:32301873-32301895 TTAGAATTTCAATTTGATTTAGG - Intergenic
1053523743 9:38808115-38808137 ATAGTAGTCCAATTTTCTCTTGG + Intergenic
1053694715 9:40625941-40625963 CTGTTATTTCAATTATATTTTGG - Intergenic
1053941703 9:43256317-43256339 CTGTTATTTCAATTATATTTTGG - Intergenic
1054195972 9:62032529-62032551 ATAGTAGTCCAATTTTCTCTTGG + Intergenic
1054270122 9:63014175-63014197 CTGTTATTTCAATTATATTTTGG + Intergenic
1054305959 9:63425165-63425187 CTGTTATTTCAATTATATTTTGG - Intergenic
1054404705 9:64749147-64749169 CTGTTATTTCAATTATATTTTGG - Intergenic
1054642433 9:67556160-67556182 ATAGTAGTCCAATTTTCTCTTGG - Intergenic
1054865348 9:69994693-69994715 CCAGGATTCCATTTTGATTTTGG - Intergenic
1055533301 9:77210028-77210050 TTAGTATTCTAATTTGTTTTAGG + Intronic
1056701569 9:88915592-88915614 CTAGTATTTCAGGTTTATTATGG + Intergenic
1057793134 9:98137333-98137355 CTATTATGCCCATTTTATATGGG + Intronic
1058493379 9:105526846-105526868 CTAATTGTCCAATTGTATTTTGG - Intronic
1059221413 9:112624014-112624036 TTAGTATTACAGCTTTATTTTGG - Intronic
1059473965 9:114528987-114529009 ATAGATTTCCAATTTTACTTGGG - Intergenic
1059624423 9:116046696-116046718 AAATTATTTCAATTTTATTTTGG + Intergenic
1185926047 X:4148011-4148033 CTAGTAATCCACTATTATATTGG + Intergenic
1186700128 X:12082033-12082055 CTCATATTATAATTTTATTTGGG - Intergenic
1186932957 X:14414771-14414793 CTACTATTCCTACTTTGTTTGGG - Intergenic
1187686554 X:21821273-21821295 CTGGCACACCAATTTTATTTTGG + Intergenic
1188607087 X:32044753-32044775 CTATTATTCCAATGTTAATATGG + Intronic
1188962061 X:36504335-36504357 CAAATTTTCCAATTTTCTTTTGG + Intergenic
1189528407 X:41851725-41851747 ATATTATTCCAATTTAATATTGG + Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1194084095 X:89505233-89505255 CCTGTATTCCTATTTTATCTAGG - Intergenic
1194856322 X:98933395-98933417 CTGGTATCCCCATTGTATTTTGG + Intergenic
1195496869 X:105546364-105546386 CGAGAATTCCATATTTATTTAGG + Intronic
1197586522 X:128354348-128354370 CAAATATTTAAATTTTATTTCGG - Intergenic
1197949071 X:131874644-131874666 CTAGGATACCAATTTTAAGTAGG - Intergenic
1198506921 X:137310097-137310119 CTATTATCCCAATTTTATCCAGG - Intergenic
1199527090 X:148804890-148804912 GTAGTTTTCCAAATTCATTTTGG + Intronic
1200289260 X:154856340-154856362 CAATTATTCCCATTGTATTTAGG - Intronic
1200436738 Y:3161119-3161141 CCTGTATTCCTATTTTATCTAGG - Intergenic
1200804610 Y:7420225-7420247 CTAATATTTAAAATTTATTTTGG - Intergenic
1201148276 Y:11078737-11078759 CTAGTTTTTCAGTTTTACTTTGG - Intergenic
1201607661 Y:15804841-15804863 TTTCTTTTCCAATTTTATTTTGG - Intergenic
1201893177 Y:18964989-18965011 CTATTATTCCTATTTTGCTTTGG + Intergenic
1201955779 Y:19620965-19620987 CCAGAACTCCAATTTTATCTAGG - Intergenic