ID: 1094345821

View in Genome Browser
Species Human (GRCh38)
Location 12:29467760-29467782
Sequence GATGGTGGTGTTCCACACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094345821_1094345823 -9 Left 1094345821 12:29467760-29467782 CCTAAGTGTGGAACACCACCATC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1094345823 12:29467774-29467796 ACCACCATCAGGAAATTCTCAGG 0: 1
1: 0
2: 2
3: 20
4: 515
1094345821_1094345830 28 Left 1094345821 12:29467760-29467782 CCTAAGTGTGGAACACCACCATC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1094345830 12:29467811-29467833 TAAAGAATCAGAAGCTCTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094345821 Original CRISPR GATGGTGGTGTTCCACACTT AGG (reversed) Intronic
901161424 1:7179021-7179043 GGTACTGGTGTTCCTCACTTAGG - Intronic
902652436 1:17845367-17845389 GATGGGGGTGGGCCACATTTTGG + Intergenic
903231396 1:21924466-21924488 GTTGGTGGTGTTCCATTCTCTGG - Intronic
907544935 1:55251620-55251642 GATGGTGCTGTCCTACTCTTTGG + Intergenic
908184167 1:61635879-61635901 GACTGTTGTGTTCCACATTTTGG - Intergenic
909858703 1:80575440-80575462 GGTGGTGGTGTTCCTCCCTCTGG + Intergenic
910290818 1:85598831-85598853 TATGGTGGTGTTTTCCACTTCGG - Intergenic
913525581 1:119689377-119689399 GATGGTGGAGTTGCACTCTCAGG + Intronic
917747875 1:178028091-178028113 GATGGTGGTGAGCCATACTGTGG + Intergenic
920502243 1:206492780-206492802 GTTGTTGGTGCTCCACACTACGG + Exonic
1063075439 10:2711735-2711757 GGTGGTGGTGTAACACACTCAGG + Intergenic
1064727343 10:18294212-18294234 GAAGGTGGTGGTCCACTCTGGGG - Intronic
1068547875 10:58371938-58371960 GATGGTTGTGTTGCACAAATAGG + Intergenic
1072261167 10:93675149-93675171 GATGGAGGTATTCCTCTCTTAGG - Intronic
1074776638 10:116772113-116772135 GATGATGGTGTTCCCGCCTTGGG + Intergenic
1077191608 11:1258093-1258115 GGTGGTTGTGTTGCACACTGCGG - Exonic
1079019348 11:16896365-16896387 GATGGTGGTGTTTAGCACTCTGG - Intronic
1084573789 11:69975869-69975891 GTTGATGGTGTTGCACACATAGG + Intergenic
1087815396 11:102652926-102652948 GATAGAGATGTTCCACATTTGGG + Intergenic
1088507462 11:110540537-110540559 CATGGTGTTGTTCCCCACATCGG - Intergenic
1089755916 11:120686800-120686822 GAAGGTGGTGATCCACGCATAGG + Intronic
1091067822 11:132533225-132533247 GATGGTGGTGTTTTACAATAGGG + Intronic
1091171703 11:133525670-133525692 AATGGTGTTTTACCACACTTGGG - Intronic
1091356089 11:134938667-134938689 GATGGAGGTGTTCCACAGTGAGG + Intergenic
1091937902 12:4447887-4447909 TATGCTGGTGGTCCTCACTTAGG + Intergenic
1094345821 12:29467760-29467782 GATGGTGGTGTTCCACACTTAGG - Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095658518 12:44700088-44700110 GATGTTGGTGCTGCTCACTTAGG - Intronic
1102462387 12:113107950-113107972 AACGGTGGTGTTTCAGACTTGGG + Intronic
1106605349 13:31223748-31223770 GCTGATTGTGTTCCAGACTTGGG - Intronic
1110835443 13:80076747-80076769 CATGATAGTCTTCCACACTTTGG - Intergenic
1111924027 13:94443755-94443777 GAAGGGGGTATTCCACACATGGG - Intronic
1121477171 14:94219722-94219744 GATGGTGGTGTTCCTTTTTTAGG - Intronic
1123058609 14:105584256-105584278 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1123082940 14:105704490-105704512 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1124089438 15:26584317-26584339 ATTGGTGGTGTCCCACACATAGG - Intronic
1126688870 15:51272024-51272046 GATGAAGGAGTTCCACACTGAGG - Intronic
1129084333 15:73072732-73072754 GATGGTCATGTTTCATACTTAGG + Intronic
1132937747 16:2490146-2490168 GATGGTGGGGGTCCACACCGTGG - Intronic
1135101047 16:19605916-19605938 AAAGGTGGTGTTCCAGGCTTTGG - Intronic
1135348416 16:21708557-21708579 GCTGGGTGTGCTCCACACTTTGG + Intronic
1140281683 16:73560458-73560480 GATGATCGTTTTCTACACTTAGG + Intergenic
1146312251 17:31778500-31778522 GATGGTGGAGTGCAACACTGGGG + Intergenic
1152985811 18:319740-319762 GATTGGAGTGTTCCATACTTTGG + Exonic
1154498527 18:14980637-14980659 GATGGAGGTGTTCCACAGTGAGG - Intergenic
1159549935 18:69884314-69884336 GATGTTGGTGTTCCACAGAATGG + Intronic
1160262637 18:77309467-77309489 GAAGGTGGTGTCCCCCACTGTGG - Intergenic
1160367823 18:78343840-78343862 GATGGTCCTGCTCCACACTCTGG + Intergenic
1161774513 19:6252072-6252094 GATGGTGCTGGTCCACACTGAGG - Intronic
927687758 2:25183885-25183907 TCTGATGGTGATCCACACTTTGG + Intergenic
931503658 2:62899635-62899657 TATGCTGGAGTTCCACACTGAGG + Intronic
931648633 2:64448945-64448967 GATGGTGGTATTCCACTTTGAGG - Intergenic
934935795 2:98464358-98464380 CATGGTGGGTTTCGACACTTGGG + Intronic
937627239 2:124057186-124057208 AATGGTGGTGTTACACAGTGAGG - Intronic
946546019 2:220744754-220744776 GAAGGATGTGTTCCCCACTTGGG + Intergenic
947683732 2:232061896-232061918 GCTGATGCTGTACCACACTTGGG + Intronic
948606010 2:239135635-239135657 GATGCTGGAGCTCCACTCTTGGG + Intronic
1169548663 20:6678710-6678732 GATGGTGGGTTTCCAGAATTAGG + Intergenic
1171050573 20:21854395-21854417 GATGCTGGTGACCTACACTTGGG - Intergenic
1171127270 20:22613456-22613478 CATGGTGGTTTTCTACACATCGG - Intergenic
1172322233 20:34004558-34004580 GGTGGAAGTGTCCCACACTTTGG + Intronic
1175182170 20:57156358-57156380 GATGGTGGTGCCCAAAACTTGGG + Intergenic
1179329160 21:40381750-40381772 GATAATGGTTTTTCACACTTTGG + Intronic
1182938398 22:34249322-34249344 GCTGGTGGTATTCTACACATTGG - Intergenic
949302944 3:2605784-2605806 GCTAGTGCTGTTCCACAGTTGGG + Intronic
949771836 3:7587625-7587647 GATAGTGGTGTGACACGCTTGGG + Intronic
954476459 3:50750788-50750810 GATGGTGGAGTAACACACTCTGG - Intronic
955287793 3:57660389-57660411 CAGGGTGGTCTTCAACACTTGGG + Intronic
958492067 3:94788810-94788832 GATGGTGCTGTTTCTCATTTTGG + Intergenic
964264946 3:154885034-154885056 GTTACTGGTGTTCCAGACTTTGG - Intergenic
964988445 3:162773967-162773989 GATGGTGCAGTTCCTCCCTTGGG - Intergenic
965165227 3:165188566-165188588 GATGGGGTTGTTGCACATTTGGG + Exonic
967515639 3:190365417-190365439 GATGGTGGGCTTCCAGCCTTAGG + Intronic
967605158 3:191436293-191436315 AAAGATGGTGTTCCACCCTTTGG - Intergenic
969129406 4:4980645-4980667 GATTGTGGATTTCCAGACTTGGG - Intergenic
971341225 4:25770830-25770852 GATGGTGGTGGTACACGCATTGG - Intronic
975594103 4:76031087-76031109 CATGGTAGTGTCCCACACTTTGG - Intronic
977724708 4:100282394-100282416 GAGGATGGTGTTCCACACTAAGG + Intergenic
978432622 4:108649769-108649791 GATGGCGGTGGTTCACACTAGGG + Intergenic
978826622 4:113032306-113032328 GATGGCGTTGTCCCAGACTTGGG + Intronic
979069773 4:116187147-116187169 GAAGGTAGGGTTACACACTTAGG + Intergenic
980153591 4:129079150-129079172 GAGGGTGGAGTGACACACTTTGG - Intronic
981576811 4:146214053-146214075 GATGCTGGTGTTGCACTCTAGGG + Intergenic
991706512 5:69363439-69363461 AATGGTGGTGTTCAACAGTGAGG + Intronic
994816473 5:104593256-104593278 GGAGTTGGTGTTCCACACTATGG - Intergenic
998941780 5:147291297-147291319 GATGGTCCTGTCCCACATTTGGG + Intronic
1003554361 6:7126757-7126779 GATGGTGGTATTCCACAGATGGG - Intronic
1006605077 6:35250297-35250319 GATGGAGGTTTTCCCTACTTGGG - Exonic
1008249475 6:49221625-49221647 GATGGTGATTTTCCTTACTTTGG - Intergenic
1009694508 6:67084154-67084176 GATGGAAATGTTCCACATTTCGG - Intergenic
1011288696 6:85752623-85752645 GATGTTGGTGATCTACACATGGG - Intergenic
1013426790 6:110019414-110019436 GACTGTGGTGTTCTGCACTTGGG + Intergenic
1014479470 6:121917860-121917882 GGTGGTGGGGTTTCAAACTTAGG + Intergenic
1029002952 7:97174927-97174949 CATGGTGATGTTTAACACTTAGG + Intronic
1030056969 7:105591655-105591677 TATGCTGGTGGTCCACACATAGG - Intronic
1031460251 7:122039855-122039877 GAGTGTGGTGGTGCACACTTGGG + Intronic
1033713029 7:143968977-143968999 GATGGTGGTGTTTCACACCAGGG - Intergenic
1034769434 7:153758891-153758913 GATCTTGCTGTTCCACTCTTAGG - Intergenic
1038613700 8:29074498-29074520 CATGGTGGTTTTCCAAGCTTGGG - Intronic
1048145040 8:131833495-131833517 GATGGAGGTGACCCACTCTTTGG - Intergenic
1051895262 9:21979970-21979992 GAAGGTAGTGTTCCAGAGTTGGG + Intronic
1052609160 9:30747924-30747946 GAAGGTGGTGGGCTACACTTGGG + Intergenic
1057507161 9:95644461-95644483 GATGGTGGAGTGCCACAGTAAGG + Intergenic
1061422759 9:130480958-130480980 GATGGGGCTGTGCCACAGTTGGG + Intronic
1185709942 X:2295980-2296002 GATGCTTGTGTGCCTCACTTGGG + Intronic
1191808636 X:65162917-65162939 GATGATGGTGATGCACACATGGG + Intergenic
1191922192 X:66268958-66268980 GATGGTTGTGTTTTAAACTTAGG - Intergenic
1192557455 X:72101725-72101747 AATGCTGGTGTTCCACTCCTCGG - Intergenic
1194399393 X:93424022-93424044 GATGGTCGTATACCACACTTTGG - Intergenic
1200060593 X:153482072-153482094 CATGGTGGGCTTCCACAATTTGG + Intronic
1200299691 X:154960675-154960697 TAGTGTGGTATTCCACACTTTGG - Intronic