ID: 1094346758

View in Genome Browser
Species Human (GRCh38)
Location 12:29478586-29478608
Sequence TTTCCCTTCTAGAAGGGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094346758_1094346761 6 Left 1094346758 12:29478586-29478608 CCTTAACCCTTCTAGAAGGGAAA 0: 1
1: 0
2: 3
3: 20
4: 191
Right 1094346761 12:29478615-29478637 TAAGATAAGATCATTGCCCTTGG 0: 1
1: 0
2: 1
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094346758 Original CRISPR TTTCCCTTCTAGAAGGGTTA AGG (reversed) Intronic
905206341 1:36344712-36344734 CTTCCCTTCTAGAGGGGAGACGG - Intronic
907104999 1:51874723-51874745 CTTCCCTTCTGGAAGGGTTAAGG - Intronic
911258802 1:95662822-95662844 GTTCTCTTCTAGGAGGTTTATGG + Intergenic
913398591 1:118402016-118402038 TTTCTCTTCTAGAAGTGTTATGG - Intergenic
918287316 1:183070146-183070168 TTTACCTTATAAAAGGGCTATGG - Intronic
919676437 1:200388114-200388136 TGTCCCTTCTAGAGGGGAAAGGG - Intergenic
919782928 1:201233452-201233474 GTTTTCTTCTAGAAGTGTTATGG + Intergenic
920433164 1:205931824-205931846 ATGCCCTTCTAGCAGGGTTGGGG + Intronic
921913813 1:220583217-220583239 TCTCACTTCTAGAAGTGTTTGGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
923501952 1:234572492-234572514 TTTTCCTTCTTAATGGGTTAAGG - Intergenic
923929576 1:238679421-238679443 ACTGCCTTTTAGAAGGGTTAGGG + Intergenic
924242459 1:242054432-242054454 TTTGCCTACTAGAAAAGTTATGG - Intergenic
1064195255 10:13238985-13239007 TTTCCATTCCAGGAGGGTTTTGG + Intergenic
1064392385 10:14953360-14953382 TTTCCCTTCTAGATGGTATCAGG - Intronic
1065063341 10:21931914-21931936 TTTCCCTTCTAAATGTGATATGG + Intronic
1068142766 10:53027721-53027743 CTTGCATTTTAGAAGGGTTAAGG - Intergenic
1068157989 10:53225187-53225209 TTGCCCATCTAGGAGGGTTGAGG + Intergenic
1069357741 10:67607004-67607026 TTTTCCTGCTGGAAGGGTTCTGG + Exonic
1071796750 10:89015911-89015933 TTTAACTACTAAAAGGGTTAAGG - Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083144549 11:60748783-60748805 TTTCCCTGAGAGAATGGTTAGGG - Intergenic
1084154924 11:67308062-67308084 TATCCCATCTAGATGGATTAGGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086112873 11:83218220-83218242 TTTGCATTTTAGAAGGGTTGAGG - Intronic
1086621054 11:88887302-88887324 TTTCCCTTAGAGAATGGTTCTGG - Intronic
1087043543 11:93824771-93824793 TTTCCCTTCTAGGAGTTTTATGG + Intronic
1087865807 11:103225356-103225378 GTTATCTTCTAGAATGGTTATGG + Intronic
1089696622 11:120219827-120219849 TTTGGCATCTAGAAGGTTTAGGG - Intronic
1091360810 11:134977407-134977429 TGTCCCTTCTCCAAGGGTTTTGG - Intergenic
1093225643 12:16479998-16480020 GTTTCCTTCTAGAAGTGTTATGG - Intronic
1094234748 12:28150874-28150896 GTTCTCTTCTAGAAGTTTTATGG + Intronic
1094346758 12:29478586-29478608 TTTCCCTTCTAGAAGGGTTAAGG - Intronic
1095332694 12:40988025-40988047 TTTCCCTTAGAGAAGGATCAAGG + Intronic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098322783 12:69264201-69264223 TTTCCATTATAGAAGGGTACAGG + Intronic
1098371578 12:69766194-69766216 TTACCTTTCTAGCAAGGTTAGGG + Intronic
1099139668 12:78956472-78956494 TTTTCTTTCTAGCAGGGGTAGGG - Intronic
1099488830 12:83262051-83262073 AGTCCCTTCTTGAAGGGTGATGG + Intergenic
1101634529 12:106527444-106527466 TTTCCCTTGGAGAAAGGTTCAGG - Intronic
1101946569 12:109141772-109141794 TTGAGTTTCTAGAAGGGTTAAGG + Intronic
1102558861 12:113747928-113747950 TTTGCATTCTAGAAGGGAGATGG - Intergenic
1103891042 12:124239378-124239400 TTTCACTTCTAGATGGCTCATGG - Intronic
1104280150 12:127369430-127369452 TTTCCCTTCTAGAACCTCTAGGG - Intergenic
1106474919 13:30090248-30090270 GTCCCCTTCCAGGAGGGTTATGG - Intergenic
1109275807 13:60302873-60302895 TTTCCCTTCTAGAAGTTTCAAGG - Intergenic
1109317734 13:60770832-60770854 GTTCTCTTCTAGAAGTTTTATGG + Intergenic
1110893777 13:80723474-80723496 TTTGCATTCTGGATGGGTTAGGG + Intergenic
1112337171 13:98525245-98525267 TTTCCTTTTTAGAAGGGTTTGGG + Intronic
1114730588 14:24988781-24988803 TTGCTCTTCTACAAGGGTTCAGG - Intronic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1117143064 14:52809494-52809516 TTTCCCTTCTAGTAGTTTTAGGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1123504405 15:20925417-20925439 TTCCCCTTATTGAAGGGTTAAGG - Intergenic
1123561651 15:21499118-21499140 TTCCCCTTATTGAAGGGTTAAGG - Intergenic
1123597895 15:21936399-21936421 TTCCCCTTATTGAAGGGTTAAGG - Intergenic
1123827265 15:24094556-24094578 TTTCCTTTCTTGAAGTGTTTTGG + Intergenic
1124431842 15:29614954-29614976 TTTCCATTCTAGAACGGTTTTGG + Intergenic
1124854731 15:33376725-33376747 GTTCTCTTCTAGAAGTTTTATGG + Intronic
1129453132 15:75661833-75661855 TTTCCCCTCTAGATGAGTGAAGG + Exonic
1202969996 15_KI270727v1_random:226243-226265 TTCCCCTTATTGAAGGGTTAAGG - Intergenic
1133283630 16:4680661-4680683 TTTCCTTTCTAGAGGGGTGAGGG + Intronic
1138744753 16:59349900-59349922 TACACCTTCTAGAAGGGTTTGGG + Intergenic
1139032836 16:62906200-62906222 TTTTCTTTATAGAAGAGTTAGGG + Intergenic
1140030209 16:71330412-71330434 TTTTTCTTCTAGAAGTTTTAAGG - Intergenic
1140811588 16:78583961-78583983 TTTTCCTTCTTGAAGTGTTTGGG - Intronic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1145858309 17:28184002-28184024 TTTCACTGCTAGAAGCGTCAGGG - Intronic
1146243653 17:31256786-31256808 TTCCCCTTATTTAAGGGTTAAGG + Intronic
1146632185 17:34478635-34478657 CTTCCCTTCTAGTTAGGTTAGGG - Intergenic
1148065782 17:44868692-44868714 TTCCCCTTCCAGAAGGGACAGGG - Intronic
1148208153 17:45792415-45792437 TTTCCCCTCTAGAAGGGGATGGG - Intronic
1148485476 17:47988044-47988066 CCTCCCTTCTACCAGGGTTAAGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1154494492 18:14945535-14945557 TGTCCCTTCTCCAAGGGTTTTGG + Intergenic
1155619770 18:27764916-27764938 ATTCCTTTCTGGATGGGTTAAGG - Intergenic
1156104841 18:33647583-33647605 TTTCCCTTTCAGGAGGGTGAAGG + Intronic
1156662974 18:39369725-39369747 GTTTCCTTCTAGAAGTTTTATGG - Intergenic
1158058259 18:53307864-53307886 ATTGCTTTCCAGAAGGGTTATGG - Intronic
1158311936 18:56168464-56168486 TTTCCCTTCTGGATGTGTTTGGG - Intergenic
1158592496 18:58789585-58789607 TTTCCCTTCTGGAAGGCTCTGGG - Intergenic
1158910851 18:62060400-62060422 TTTCTCCTCTATAAGGGTGATGG + Intronic
1160612628 18:80100338-80100360 TTTCCCTTCTATTAAGGTTGAGG + Intergenic
1160727480 19:623797-623819 TGTCCCTTCTAGAGGGGTCGAGG - Intronic
1164393061 19:27842407-27842429 TTTACCTTTGGGAAGGGTTAGGG + Intergenic
1165026069 19:32962504-32962526 ATTTTCTTCTAGAAGTGTTATGG - Intronic
925031294 2:651942-651964 TTTCTCCTGTAGAAGGTTTAGGG + Intergenic
926299906 2:11595155-11595177 TGTCAAGTCTAGAAGGGTTAAGG + Intronic
928347142 2:30510483-30510505 TTTCCTTTCTAGAAGGTTTGTGG + Intronic
928519921 2:32078697-32078719 TTTCCCTTATGGTAAGGTTAAGG - Intronic
932873791 2:75429909-75429931 TTTCTTTTCTAGAAGTTTTATGG + Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933640705 2:84756401-84756423 TTTTCCTTGTAGAAGGCTAATGG - Intronic
934055379 2:88247166-88247188 TTTCCTTCCTTGATGGGTTAAGG - Intergenic
937666621 2:124495286-124495308 TTTCACTTCTAGAAGTCTTCAGG - Intronic
941466951 2:165839307-165839329 TTTCCCCTCTAGAATGGGTTGGG + Intergenic
941599374 2:167522139-167522161 TTTCCCTTCTAGAAGCCTTATGG - Intergenic
942458561 2:176153714-176153736 GCTTCCTTCTGGAAGGGTTAAGG - Intronic
943670017 2:190649613-190649635 TTTCCCTCCGAGAAAGGTTGGGG + Intronic
944493978 2:200287861-200287883 GTTCTCTTCTAAAAGAGTTATGG - Intergenic
945983241 2:216333043-216333065 GTTTTCTTCTAGAAGAGTTATGG - Intronic
946766885 2:223049172-223049194 TTTTGCTTCTAGAAGTTTTATGG - Intergenic
947251282 2:228107403-228107425 TTCCCATTTTAGAAGGATTAGGG + Intronic
948882389 2:240866568-240866590 ATTCCCTTCTAGAAGGAAAAGGG + Intergenic
1175547258 20:59786310-59786332 TTTCCCTTCAAAAAAGGTCATGG + Intronic
1178783550 21:35630062-35630084 TTTCCCACCAAGAAGGGTCAGGG + Intronic
1180841207 22:18959718-18959740 TGTCCCTTCTGGAAGGGTGCTGG + Intergenic
1181060291 22:20279076-20279098 TGTCCCTTCTGGAAGGGTGCTGG - Intronic
1181613454 22:24035432-24035454 TTTCCTTTCTAGGAGAGTTGTGG + Exonic
949799592 3:7889016-7889038 GTTGCCTTCTAGAATTGTTATGG - Intergenic
950223018 3:11211037-11211059 CTTACCTTCTAGATGGATTAAGG + Intronic
950612353 3:14134497-14134519 TTTCCCTTCCATCAAGGTTACGG - Intronic
951112750 3:18824088-18824110 TTTCCCTTTTAGAATGGAAATGG - Intergenic
952311569 3:32195178-32195200 TTTCCTTTCTAGAGGGGTAAGGG + Intergenic
952485035 3:33801097-33801119 TTGGGCTTCTAGAGGGGTTAGGG + Intronic
953860644 3:46541491-46541513 TTGCCCTTCTGCAAGGTTTATGG - Intronic
955094539 3:55784022-55784044 TTTTCATTCTAGAAGGGGAAGGG + Intronic
955281972 3:57602434-57602456 TTTCCCTTCCAGAAGGGGATTGG + Intergenic
955315140 3:57932334-57932356 TTTCCCTTCTAGATCGTCTAAGG + Intergenic
955366234 3:58312614-58312636 TTTCCCATCTTGAAGAGATAAGG + Intronic
956673040 3:71709221-71709243 TCTCCCTTCTAGAAAATTTATGG + Intronic
957261447 3:77907306-77907328 TTTCTCTTCTAGGAGTTTTACGG - Intergenic
957902994 3:86521200-86521222 TTTTCCATTTAGAAGGGTTATGG - Intergenic
959082591 3:101817671-101817693 TTTTCTTTCTGGAAGGGGTATGG + Intronic
959305369 3:104657846-104657868 TTTCCCTTTTAGTAGGGACAGGG + Intergenic
963503518 3:146158154-146158176 TCTGCCTTCTAGATGGGATAAGG - Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965392039 3:168116698-168116720 TTTCCCTACTGGTAGGGTCATGG + Intergenic
965543782 3:169895196-169895218 TTTCCCTTCTTGACTGGTTTTGG + Intergenic
965954986 3:174359181-174359203 TCTCCCTACTAGATGTGTTATGG + Intergenic
966192855 3:177287251-177287273 TTTCCCTGCTTCAAGGGTAAAGG - Intergenic
969686664 4:8679201-8679223 TGTTCCTTCTAGAGGGTTTATGG + Intergenic
971365925 4:25977141-25977163 TTTACCTTCTAAAGGGGTTAAGG - Intergenic
974914086 4:68157898-68157920 TTTCACTTCTAGAAGCCTTCTGG + Intergenic
974939453 4:68447539-68447561 TTTTCTTTCTAGAAGTCTTAAGG + Intronic
976111190 4:81675625-81675647 TTTTAATTCTAGAAGAGTTAGGG + Intronic
977362684 4:96026159-96026181 TTTCCATGCTGAAAGGGTTATGG - Intergenic
978881156 4:113704244-113704266 TTTTCATTCTAGAATTGTTAAGG - Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979486643 4:121278144-121278166 TTTCCTTCCCAGAAGGGTTTTGG + Intergenic
979589138 4:122458414-122458436 CTTCCATTCTGGAAGGGTAAAGG - Intergenic
981103406 4:140855109-140855131 TTGCCCTTCTGGATGGCTTAAGG + Intergenic
981907357 4:149936916-149936938 GTTTCCTTCTAGAAGTTTTATGG + Intergenic
981947006 4:150359524-150359546 TTTCTCCTCTAGTATGGTTAAGG - Intronic
985314066 4:188635776-188635798 TTTGCTTTCTGTAAGGGTTAGGG - Intergenic
995914896 5:117233275-117233297 TTTCCCTAATAAATGGGTTAAGG + Intergenic
999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG + Intronic
1000499321 5:162029500-162029522 TATCTCTTCTAGAAGGTTTGAGG - Intergenic
1000774524 5:165402326-165402348 TTTCCTTTTTAAATGGGTTATGG + Intergenic
1001117449 5:168951704-168951726 GTTCCCTTCTAGAAGGAGTAGGG - Intronic
1003713021 6:8614544-8614566 ATTCCCTTCTAGAAGGTGTAGGG - Intergenic
1004503288 6:16227469-16227491 TCTCACTTCTAGCATGGTTAAGG + Intergenic
1004827525 6:19439263-19439285 TTTCTCTTCTAAAAGGGTGAAGG - Intergenic
1005006631 6:21293704-21293726 TTTCCTTTCTAGAAGTGTTTAGG + Intergenic
1005380663 6:25231424-25231446 TTGCCCTTCTACAAGGGGTGGGG + Intergenic
1005914447 6:30340490-30340512 TTTCACATCTAGGAGGGATAGGG - Exonic
1007723399 6:43899594-43899616 TGTCCCTTAGAGAAGGGTTGAGG + Intergenic
1008041882 6:46810571-46810593 TTTACCTTCTAGAATCTTTATGG + Intronic
1008049123 6:46882091-46882113 TTTCAGTTCCGGAAGGGTTACGG - Exonic
1008604672 6:53128789-53128811 TTTTCCTTCTCCAAGAGTTATGG - Exonic
1010038194 6:71350978-71351000 CTTTCCTTGTAGAAGAGTTAGGG - Intergenic
1010779160 6:79923823-79923845 TTTCCCTATTAGAAGACTTATGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014237948 6:118981714-118981736 TTAGCCTTCCAGAAGGGTTCTGG + Intronic
1017072554 6:150588646-150588668 TTTCCCTTAAAAAAGGGTGACGG - Intergenic
1017571949 6:155754541-155754563 TTTTCCTTTTAGAAGGATAATGG + Intergenic
1018712311 6:166505808-166505830 TTTCTTTTCTAGATCGGTTAAGG + Intronic
1020822920 7:12992561-12992583 TTTACTTTCTAGGAGGGTGATGG + Intergenic
1020871469 7:13634998-13635020 TTTTTCTTCTAGAAGTTTTATGG - Intergenic
1021170439 7:17392580-17392602 TTTTCCTTATAGAATTGTTATGG + Intergenic
1021201621 7:17734172-17734194 TTTCTCTTCTAGATGTTTTAAGG + Intergenic
1022043326 7:26601801-26601823 TTTTCCTTCCAGAAGGGAGAAGG + Intergenic
1022192947 7:28034735-28034757 TGTACTTTCTAGAAGGATTATGG - Intronic
1022343749 7:29493539-29493561 ATTCCATTTTAGATGGGTTAGGG - Intronic
1023349912 7:39310054-39310076 TTTGCCTTCTTGCGGGGTTACGG - Intronic
1023566178 7:41525874-41525896 TTTCCCTTCTAGGTGTTTTAAGG - Intergenic
1024439510 7:49399721-49399743 TTTACCTTCTAGAAGAGACAAGG - Intergenic
1025794450 7:64725583-64725605 TATCACTTCTAGAAGCTTTATGG + Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027862379 7:83601157-83601179 TGTCCCTTCTAGAAGATCTAGGG - Intronic
1028154364 7:87412817-87412839 TTTAACTTCAAGGAGGGTTAAGG - Intronic
1030714179 7:112789686-112789708 TGTCCCATCTAGAAGTGTCAAGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033292311 7:140096912-140096934 TTTCACTTCTAGATGGCTTCTGG + Exonic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1038784904 8:30603378-30603400 TTTCCTTTCTAGATGGCATATGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041657507 8:60368645-60368667 TAGCCATTCTAGAAGGGGTAAGG - Intergenic
1042844210 8:73154169-73154191 TTTACCTTTTAGAAGGGGTGAGG + Intergenic
1045672415 8:104571020-104571042 TTGTCATTCTAGAAGGGATATGG - Intronic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047022563 8:120791334-120791356 TTTTCCTTCTAGAATTATTATGG - Intronic
1047383586 8:124387176-124387198 TTCCCCTTTTAGAATGGTTTCGG + Intergenic
1047633886 8:126738428-126738450 GTTCTCTTCTAGAAGTTTTATGG + Intergenic
1050938890 9:11433592-11433614 TTTTCTTTCTAGAAGGCTTGCGG - Intergenic
1051236896 9:15010626-15010648 TTTACCTTCTAGCAGTTTTATGG + Intergenic
1051373893 9:16384490-16384512 ATTTTCTTCTAGCAGGGTTATGG + Intergenic
1055867352 9:80831224-80831246 TATCCCTTCTAGAGGGACTAGGG + Intergenic
1057555341 9:96083490-96083512 TTTCCTTTCTAGAAGGTGTTTGG + Intergenic
1058900307 9:109436652-109436674 TTTTCCCTTTTGAAGGGTTAGGG - Intronic
1059586328 9:115611300-115611322 TTGCTCTTCTAGAAGGGATCTGG - Intergenic
1062603953 9:137334619-137334641 ATTTCCTTCTAGAATGTTTATGG - Intronic
1186375936 X:9001324-9001346 TTTTCCTTCTAGCAGATTTATGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187080513 X:15981831-15981853 TTTCCTTGGTAGAAGGGTTGGGG + Intergenic
1187163191 X:16783155-16783177 TGTGCCTGCTAGAAGGGTAAAGG - Intergenic
1189383948 X:40521563-40521585 TTTCCCTTCCAGAAGGCCAAAGG + Intergenic
1190434016 X:50405710-50405732 TTTCCCTTCCAGAAGGTTCCAGG - Intronic
1192954591 X:76055586-76055608 GTTATCTTCTAGAAGGTTTATGG + Intergenic
1194528988 X:95020547-95020569 GTTTCCTTCTAGAAGTTTTAAGG - Intergenic
1196554609 X:117071442-117071464 CTTCACTTCTAGAAGATTTAAGG - Intergenic
1200763656 Y:7062580-7062602 TTTCCCTTCTTGATGGTTTTGGG + Intronic
1200897292 Y:8389288-8389310 TTTCCATACTAGAAGTGTTTTGG - Intergenic