ID: 1094348151

View in Genome Browser
Species Human (GRCh38)
Location 12:29494392-29494414
Sequence TACCTGTGTTGAGAGAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094348149_1094348151 -7 Left 1094348149 12:29494376-29494398 CCCAGAATGTTTATATTACCTGT 0: 1
1: 0
2: 0
3: 25
4: 293
Right 1094348151 12:29494392-29494414 TACCTGTGTTGAGAGAGTGTTGG 0: 1
1: 0
2: 0
3: 16
4: 162
1094348150_1094348151 -8 Left 1094348150 12:29494377-29494399 CCAGAATGTTTATATTACCTGTG 0: 1
1: 0
2: 1
3: 13
4: 216
Right 1094348151 12:29494392-29494414 TACCTGTGTTGAGAGAGTGTTGG 0: 1
1: 0
2: 0
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094348151 Original CRISPR TACCTGTGTTGAGAGAGTGT TGG Intronic
901799930 1:11702440-11702462 TATGTGTGTTGTGAGTGTGTAGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
906642693 1:47450784-47450806 TACATATGTGGAGAGGGTGTGGG - Intergenic
906676686 1:47698345-47698367 TATCTGTAGTGAGAGGGTGTGGG - Intergenic
908945639 1:69493047-69493069 TAGCTGGGTTAAGGGAGTGTAGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
910947200 1:92606966-92606988 TAGCAGTGGTGAGAGAGTGGGGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912106661 1:106285686-106285708 TACCTGTGTGGAGGGTATGTGGG + Intergenic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915808571 1:158880877-158880899 TACCTCAGTTGAGGAAGTGTTGG - Intergenic
915813321 1:158939228-158939250 TACCTCAGTTGAGGAAGTGTTGG - Exonic
916464263 1:165058109-165058131 CACCTGTGTTGTGAGAGAGCTGG - Intergenic
922163076 1:223092653-223092675 TACCTATGGTGAGAGGGTGTCGG - Intergenic
922690702 1:227687446-227687468 TCAGTGTGTTGAAAGAGTGTTGG - Intergenic
1072312442 10:94169561-94169583 TAACTATGCTGAGACAGTGTAGG - Intronic
1076870146 10:133189008-133189030 TCACTGTGTTGAGAATGTGTGGG - Intronic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1078716405 11:13843488-13843510 TACCTGTGGTGAGAGGGAGGTGG - Intergenic
1078846833 11:15126090-15126112 CATCTGAGTTGAGAGAGTTTGGG + Intronic
1080048685 11:27836435-27836457 TACTTGTGTGGAGAGTATGTGGG + Intergenic
1080273826 11:30480888-30480910 TACCTGTGGAGATAGAGTGTGGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081578490 11:44334682-44334704 AAGCTGTGCTGAGAGACTGTGGG - Intergenic
1093548951 12:20383901-20383923 TCTCTGTGTTGAGTGAGAGTAGG + Intronic
1094348151 12:29494392-29494414 TACCTGTGTTGAGAGAGTGTTGG + Intronic
1094524560 12:31223025-31223047 TACCTGTGGTGAGTGGGTGCCGG - Intergenic
1095490617 12:42729761-42729783 TAGCTGTGTTGTGAGGGTGCAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096192569 12:49630063-49630085 TATTTGTGTTGAGAGAGCTTTGG + Intronic
1096480671 12:51938829-51938851 TGTCTGTGTTGGGAGAGGGTTGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097713236 12:62937613-62937635 TACCTGTAATGAGAAAGTCTTGG + Intergenic
1099780540 12:87189715-87189737 TACCTGTATGGAGAAAGTGGGGG + Intergenic
1100002223 12:89850966-89850988 TTCCAGTGTTGACTGAGTGTTGG + Intergenic
1100638252 12:96456738-96456760 TGCCTGGGTTGAAAGAGAGTGGG + Intergenic
1102069221 12:110003547-110003569 TGTCTGTGTTGAGAGAGAGGAGG + Intronic
1102771800 12:115483831-115483853 TACTTGTGTAGAGGAAGTGTTGG - Intergenic
1105543045 13:21331248-21331270 TACCTGTGTGCAGAGAGAGTGGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109734759 13:66468159-66468181 TTCCTGGGATGAGAGAGTGTAGG - Intronic
1109969467 13:69747982-69748004 TACCTGTGTTGAAAGATTAATGG - Intronic
1109969651 13:69751149-69751171 TATCTGTGTTGGGAGCATGTGGG + Intronic
1110384292 13:74890780-74890802 TATGTGTGTTGAGAGAGGGAGGG - Intergenic
1112728327 13:102330501-102330523 TTCCTGTGTCAAGAGAGTATGGG - Intronic
1115682552 14:35757829-35757851 TACCTCTGTTGTGAGCTTGTTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1118721708 14:68599147-68599169 CCCCTGTGTTCAAAGAGTGTGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122737085 14:103848915-103848937 TCTCTGTGATGGGAGAGTGTAGG + Intergenic
1129537445 15:76325591-76325613 TCCCAGTGTTGGTAGAGTGTGGG - Intergenic
1131190301 15:90310038-90310060 GACCTGTGGAGAGTGAGTGTTGG - Intronic
1132325871 15:100969646-100969668 CACCTGTGGTGAGGGAGGGTGGG - Intronic
1134019310 16:10910487-10910509 TACCTCTGTTGAATGAGTGATGG - Intronic
1135791376 16:25399665-25399687 TAACTGTATTGAGAGACTGACGG - Intergenic
1138218136 16:55223589-55223611 TACCTGTGTTGAGAAGGATTTGG - Intergenic
1141851408 16:86648864-86648886 TACCTGTGTTTAGAGGCAGTTGG + Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1147114418 17:38288330-38288352 TACCTATGTTGAGAGATTCAGGG - Intergenic
1147779997 17:42934322-42934344 CTGCTGTGTTGAGAGACTGTAGG - Intergenic
1148415191 17:47500869-47500891 TACCTATGTTGAGAGATTCAGGG + Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153578195 18:6544063-6544085 TACTTGGGCTGAGTGAGTGTGGG + Intronic
1155142879 18:23058849-23058871 TTCCTGTGTGGAGACAGTCTTGG - Intergenic
1155424918 18:25696928-25696950 TGCCAGTGTTGAGATAGAGTCGG + Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163732747 19:18959375-18959397 AACCTTTGTCAAGAGAGTGTAGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164548599 19:29189279-29189301 GAGCTGTGTGGAGAGAGAGTGGG - Intergenic
927011348 2:18907839-18907861 TAACTATGTTGAGAGATGGTGGG - Intergenic
928799282 2:35067546-35067568 AATCTGTGTTGAGAAAGTGTGGG - Intergenic
929124765 2:38513078-38513100 TCCCTGTGTAGAGAGAGGGAGGG + Intergenic
930695870 2:54411284-54411306 TACCTGGGCTGAGAGACTGAGGG - Intergenic
932445853 2:71780852-71780874 TAAGTGTGATCAGAGAGTGTGGG + Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933021898 2:77204854-77204876 TACCTGAGTTGAGAGTGGGTGGG - Intronic
937472422 2:122185677-122185699 TTCAGGTGTTGAGAGAGGGTTGG + Intergenic
938071811 2:128312360-128312382 TACTTGTCTTGGGGGAGTGTTGG + Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938660628 2:133483391-133483413 CTCCTGTATGGAGAGAGTGTTGG - Intronic
943521614 2:188958575-188958597 TGACTGTTTTGAGAAAGTGTAGG + Intergenic
943679705 2:190755385-190755407 TTCTTGTGTTGAGATTGTGTTGG + Intergenic
946092876 2:217246326-217246348 AACCTAGGTTGAGAGGGTGTTGG - Intergenic
946276353 2:218634611-218634633 TACCTGGATTAAGAGAGTCTGGG - Exonic
946361254 2:219220450-219220472 TACCTGTGGGGAGAAAGGGTTGG + Exonic
946364353 2:219239449-219239471 TACCTGAAGTGAGAGAGGGTGGG + Exonic
946941589 2:224775113-224775135 TACCTGTGTTAACAGATTATGGG + Exonic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1170403350 20:16011069-16011091 AACCTGTGCTGAGACTGTGTTGG + Intronic
1173175434 20:40761631-40761653 TAGCTGGGTTGAAAAAGTGTGGG - Intergenic
1173431919 20:42995651-42995673 ATCCTGTGTTCTGAGAGTGTGGG - Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175792844 20:61753046-61753068 TAACTGTGTTTAGAGAAGGTGGG + Intronic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1179271655 21:39856145-39856167 TACCTCTGTTGACATAGAGTGGG + Intergenic
950504413 3:13385460-13385482 TACTTGTGTTTAGATAGTGACGG - Intronic
950622144 3:14214555-14214577 TTCCTGTGTTGCGGAAGTGTGGG + Intergenic
952546236 3:34422552-34422574 TGCATGTGTTGTGAGAGTGGGGG + Intergenic
954619542 3:51987637-51987659 GACATGTGATGGGAGAGTGTGGG + Intronic
955120221 3:56050668-56050690 TACAGGTGTTGAGAGAATATGGG - Intronic
956086510 3:65616774-65616796 TACCTGTGTTCAGGTTGTGTTGG - Intronic
956635976 3:71365500-71365522 CCCCTGTGTTAAGATAGTGTAGG + Intronic
957659488 3:83128975-83128997 TACCTGGGTAAAGAAAGTGTAGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
967639511 3:191844538-191844560 ACCCTGTGTTCAGCGAGTGTTGG - Intergenic
975578811 4:75888877-75888899 TTGCTGTGTTAAGACAGTGTAGG - Intronic
975647143 4:76556233-76556255 TTCCTCTGTTGGGAAAGTGTTGG + Intronic
978756917 4:112312793-112312815 TAACTGTGTTGAGACACTGTGGG - Intronic
981422363 4:144565673-144565695 AACCAGTGGGGAGAGAGTGTTGG + Intergenic
982027103 4:151261846-151261868 TACCTGGGTGGAGTGTGTGTGGG + Intronic
983043845 4:162961253-162961275 TTCCAGTGTTGATAGACTGTAGG - Intergenic
983420526 4:167509679-167509701 TATCTGAGTTGAGACAGGGTAGG - Intergenic
984988020 4:185350301-185350323 TGCCTCTGATGACAGAGTGTGGG - Intronic
985404160 4:189619638-189619660 TGCCTGTCTAGAGAGAGGGTTGG + Intergenic
986005057 5:3660650-3660672 GACGGGTGTTGAGAGATTGTAGG + Intergenic
987023809 5:13902595-13902617 TAGCTGTGATGAGAAAGTATGGG - Intronic
987598425 5:20032989-20033011 TACCAATGTTGAGATATTGTGGG + Intronic
991645432 5:68796181-68796203 AAGCTGTTTTGAGAGTGTGTGGG - Intergenic
992318905 5:75590977-75590999 TACCTCTGGTTTGAGAGTGTTGG - Intronic
992558617 5:77928374-77928396 TACCTGTCTTAAAAGAGTGAAGG + Intergenic
993496381 5:88614387-88614409 TCACTGTGTTGAGAGAGGTTAGG - Intergenic
997640349 5:135444918-135444940 TTCCTGTGTGGATGGAGTGTTGG + Exonic
998843030 5:146276543-146276565 TCCCTGTCTTGAGAGGCTGTGGG - Intronic
1000350937 5:160352308-160352330 TACCTTTTTTGAGAGACTTTGGG + Intronic
1001922830 5:175613938-175613960 CATCTGTGTTCAGAGAGTGGAGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003595779 6:7472972-7472994 TGTCTGTGGTGAGAGAGAGTGGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006886975 6:37390076-37390098 TTCCTGTGTTCAGAGAGGGAGGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1011408856 6:87044583-87044605 GAACTGTAGTGAGAGAGTGTGGG - Intergenic
1012187476 6:96237314-96237336 TCCCTGTGTTGAGGGAAGGTGGG - Intergenic
1017647863 6:156555624-156555646 TGCCAGTGTGGAAAGAGTGTGGG - Intergenic
1018210791 6:161479804-161479826 TCCCTGTATTGTGACAGTGTGGG + Intronic
1018615100 6:165679558-165679580 TTCCTGTGCTGTGACAGTGTGGG - Intronic
1019897345 7:3992505-3992527 TCCCTGCATTGAGAGAGTGCAGG + Intronic
1019967647 7:4513094-4513116 TATGTGTGTTGAGAGAGAGAGGG - Intergenic
1026344580 7:69463126-69463148 TATCTGTGTAGAGAGAGTACAGG - Intergenic
1027602559 7:80257195-80257217 TCCCTGTGCTGAGAGAGTCAAGG + Intergenic
1032977459 7:137241941-137241963 TAACTGTGTTGAGAGAGGTGAGG - Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034578540 7:152023169-152023191 TAACAGTGTTGAGACAGAGTAGG + Intergenic
1037005983 8:13780304-13780326 TACTTGTGTAGAGAGAATGGGGG - Intergenic
1037737660 8:21580357-21580379 TTCCTGTGTTCAGAGAGAGAGGG - Intergenic
1038374278 8:27022927-27022949 TATCTATGTGGAGATAGTGTTGG + Intergenic
1038647847 8:29375936-29375958 GATCTGTGTTGAGAGAAAGTAGG - Intergenic
1038926086 8:32141070-32141092 TTCCTGTTTTGAGAGAGTTTAGG - Intronic
1041220679 8:55648321-55648343 TACCAGTGGTGAGAGTGAGTGGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044108939 8:88247868-88247890 TCACTGTGATGAGAGAGAGTAGG - Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1046886525 8:119373471-119373493 TTCATGTGTTAAGAGAATGTAGG - Intergenic
1048511026 8:135062816-135062838 TAAATTTGTTGAGAGAATGTGGG - Intergenic
1051110264 9:13627486-13627508 TGCCTTTGTTGTCAGAGTGTTGG + Intergenic
1051158423 9:14177019-14177041 TACCAGTGATAAGAAAGTGTTGG + Intronic
1052188008 9:25622067-25622089 TTCCTTTGTTAAGAGAGTGGAGG + Intergenic
1054754213 9:68940771-68940793 TACCTGTTTGAATAGAGTGTAGG - Exonic
1054798980 9:69327791-69327813 GACCTGTGTTTGGAGAGTATGGG - Intronic
1054974526 9:71126808-71126830 TGCCTGTGGTGACAGAGAGTGGG + Intronic
1056107296 9:83359987-83360009 TACCTGGGTTGAAAGAGTGAGGG + Intronic
1185868122 X:3640615-3640637 TACCTGTGTTGGGTGAGATTTGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1188902997 X:35758210-35758232 TGCCTTTGTTGAGAAAGAGTTGG + Intergenic
1190653794 X:52593201-52593223 AACCTGTAAAGAGAGAGTGTAGG - Intergenic
1193044195 X:77034336-77034358 TACCAGTGTTGACAGTGGGTGGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195514364 X:105756278-105756300 ACCCTGTGTTGCGAGAGAGTAGG + Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1198505870 X:137300955-137300977 TACCTGTGATGTGTGAGTCTGGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200796117 Y:7342732-7342754 TACCTGTGTTGGGTGAGATTTGG + Intergenic
1201525552 Y:14929662-14929684 CACCTGTGTAGAGACAATGTTGG + Intergenic
1201612365 Y:15857703-15857725 TATCTGTGTGTAGAGACTGTTGG - Intergenic