ID: 1094350271

View in Genome Browser
Species Human (GRCh38)
Location 12:29516487-29516509
Sequence CTACAAAACCACATGGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094350267_1094350271 -10 Left 1094350267 12:29516474-29516496 CCAAAACCTGAGCCTACAAAACC 0: 1
1: 0
2: 0
3: 19
4: 259
Right 1094350271 12:29516487-29516509 CTACAAAACCACATGGACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 153
1094350266_1094350271 -1 Left 1094350266 12:29516465-29516487 CCATCACGGCCAAAACCTGAGCC 0: 1
1: 0
2: 0
3: 12
4: 88
Right 1094350271 12:29516487-29516509 CTACAAAACCACATGGACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 153
1094350265_1094350271 0 Left 1094350265 12:29516464-29516486 CCCATCACGGCCAAAACCTGAGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1094350271 12:29516487-29516509 CTACAAAACCACATGGACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094350271 Original CRISPR CTACAAAACCACATGGACCT TGG Intronic
902509479 1:16958424-16958446 CTACACAACCACACTGAACTTGG - Intronic
905127939 1:35729044-35729066 TTGGAAAACCAGATGGACCTAGG - Intronic
906670357 1:47649704-47649726 CTTCAAAAGCACCTGGGCCTGGG - Intergenic
908496920 1:64703766-64703788 CTACAAAAACACATGGGGCCAGG + Intergenic
909362544 1:74780691-74780713 GTTCAAAACCACTTGGACCTGGG - Intergenic
909749978 1:79147158-79147180 CTATGAAAACACATGGACATAGG - Intergenic
910699289 1:90055473-90055495 CTATAAAACCACCTAGGCCTGGG - Intergenic
911244165 1:95498549-95498571 GTAAGAAACCACATGGCCCTGGG - Intergenic
916198171 1:162244403-162244425 ATTCAAAACCACATAGAACTTGG - Intronic
1071088966 10:81897270-81897292 ATGGAAAACCACAGGGACCTAGG + Intronic
1073522482 10:104146639-104146661 CTTCGGAATCACATGGACCTGGG + Intronic
1073748778 10:106500214-106500236 TACCAAAACCACATGCACCTGGG - Intergenic
1073853014 10:107643282-107643304 CCACAAAGTCACATGGACATAGG - Intergenic
1076497856 10:130909503-130909525 CAGGAAAACCACATGGGCCTCGG + Intergenic
1079453896 11:20620748-20620770 CTTCAAAGCCAGATAGACCTGGG - Intronic
1081108518 11:39102323-39102345 CAATAAAAACAGATGGACCTAGG - Intergenic
1083586770 11:63865409-63865431 CAAAAAAAGTACATGGACCTTGG - Intronic
1084362625 11:68678675-68678697 CTACGAAAACACATGGACTTAGG + Intergenic
1085530145 11:77187619-77187641 CCCCAAAACCCCAGGGACCTGGG - Intronic
1087106298 11:94411401-94411423 CTTCAAAATCATCTGGACCTGGG + Intergenic
1087620713 11:100538471-100538493 CTACAAAAGCACCTGGATATAGG + Intergenic
1087763629 11:102127292-102127314 CTACAAAACCATATCCTCCTGGG - Intronic
1094350271 12:29516487-29516509 CTACAAAACCACATGGACCTTGG + Intronic
1094447815 12:30551098-30551120 CTGTAAAATCACATGGACTTTGG - Intergenic
1094655768 12:32418578-32418600 GTGCTAAACCACCTGGACCTTGG + Intronic
1096956844 12:55534786-55534808 GTACAAAACTCCAAGGACCTGGG + Intergenic
1101284785 12:103300069-103300091 CTACAAATCTACATAGACTTTGG + Intronic
1102255947 12:111415117-111415139 CTACAGAGCCACAGGGGCCTGGG - Intronic
1103676722 12:122661561-122661583 CTACAAAATCTAATGGCCCTTGG - Intergenic
1104767320 12:131338625-131338647 GTACAAAACCAAATGGTCCGTGG + Intergenic
1105762034 13:23524228-23524250 CTGGTTAACCACATGGACCTGGG - Intergenic
1107631175 13:42344138-42344160 CTCCAAAACTCAATGGACCTGGG - Intergenic
1111008451 13:82281114-82281136 CTGCTAAGCCAGATGGACCTTGG + Intergenic
1113284628 13:108832435-108832457 ATACAAATCCACATGGGGCTGGG - Intronic
1113824263 13:113238388-113238410 CTACAAAACTACAAAAACCTGGG + Intronic
1116789014 14:49319580-49319602 CTAGAAAAGCAGATGGACCTGGG - Intergenic
1116854297 14:49938230-49938252 CAGCAGAACCACTTGGACCTAGG - Intergenic
1117358079 14:54945537-54945559 CTACAAAAAAACATAGACTTTGG - Intronic
1118086933 14:62428570-62428592 CGACAAAACCACATGAAGCCTGG + Intergenic
1119388122 14:74271473-74271495 TTACAAAATCACTTGAACCTAGG + Intergenic
1119506682 14:75179076-75179098 CTACAAAACCCCATTGTCATAGG - Intergenic
1119972648 14:78989278-78989300 CAAAAAAACCACATAGATCTGGG - Intronic
1120077593 14:80177055-80177077 GCAGAAAATCACATGGACCTTGG - Intergenic
1120982534 14:90303147-90303169 TTACAAATGCAAATGGACCTGGG + Intronic
1125089620 15:35774891-35774913 CTCCAACACCACCTGGAGCTTGG - Intergenic
1128269047 15:66293250-66293272 CTCCATTCCCACATGGACCTGGG + Intronic
1130107624 15:80940935-80940957 CTAAAAGACCACATGGAGTTGGG - Intronic
1130315619 15:82793186-82793208 CAGGAAAATCACATGGACCTGGG - Intronic
1134300552 16:12986846-12986868 CTTGCAAACCACATGAACCTGGG - Intronic
1134769229 16:16791723-16791745 CTTCAAATTCAGATGGACCTGGG - Intergenic
1136128191 16:28200617-28200639 CTAGAAAAAAACATGGGCCTTGG + Intronic
1138182553 16:54951794-54951816 CATCAAAAACATATGGACCTGGG - Intergenic
1139517595 16:67460890-67460912 CTTCAGAGCCACAAGGACCTGGG + Intronic
1149357044 17:55850144-55850166 CCACAAAAGCAAATGTACCTAGG + Intergenic
1151048384 17:70948184-70948206 CTACACAACCCCAGTGACCTGGG + Intergenic
1152467007 17:80472138-80472160 CTGCACACCCACATGGCCCTTGG - Intronic
1157344163 18:46808618-46808640 CTCCCAAATCACATGAACCTAGG + Exonic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1160668679 19:345391-345413 CTGCAGAACCAAATGGCCCTGGG - Intergenic
1163472742 19:17506812-17506834 CTGCAAGACCAAAGGGACCTTGG + Intergenic
1164685125 19:30161460-30161482 CTTCAGAACCACAGGGACCAGGG + Intergenic
1167866365 19:52331886-52331908 CTTGTAACCCACATGGACCTAGG - Intergenic
1167996061 19:53403068-53403090 CAACAAAATCACATGAACCTGGG + Intronic
1202637235 1_KI270706v1_random:52934-52956 CTACAATTCCACATGAACATTGG + Intergenic
925872224 2:8281376-8281398 ATTCAAAGCCACGTGGACCTGGG + Intergenic
929142031 2:38675080-38675102 CAAGAAAACCACTTGAACCTGGG + Intronic
929600075 2:43199388-43199410 CTCCAAACCCTCATGGACCAGGG + Intergenic
930192048 2:48469967-48469989 CTACACAGACACATGGCCCTGGG - Intronic
930286612 2:49436982-49437004 CAATAAAAACACATGGACGTAGG + Intergenic
931082713 2:58793324-58793346 CTGCAGAGTCACATGGACCTGGG - Intergenic
934791104 2:97060878-97060900 CTGCCTAACCACATGGTCCTTGG + Intergenic
936804925 2:116319530-116319552 CTAGAATTCCACATGGACATAGG + Intergenic
936916697 2:117647133-117647155 CCATAAAACCACAGTGACCTAGG + Intergenic
939210334 2:139166651-139166673 CTAGAAAGAAACATGGACCTTGG + Intergenic
940494174 2:154404195-154404217 CTACAAAACCACATTGAATGTGG + Intronic
941649875 2:168081253-168081275 CTACAAAGCCACAGGGACAGAGG + Intronic
943357265 2:186872033-186872055 CTGCAAAATTACAAGGACCTTGG - Intergenic
945528179 2:210915186-210915208 GTACAAAAACACATAGACCAAGG + Intergenic
946686131 2:222272069-222272091 CTACCAGACAACATTGACCTGGG + Intronic
1169725801 20:8728679-8728701 CCACAAAATCACATTGACTTTGG + Intronic
1170920438 20:20673677-20673699 CTATAAAACCACCTGCAACTGGG - Intronic
1170952578 20:20950297-20950319 CAACATTACCACAGGGACCTGGG - Intergenic
1173568903 20:44064322-44064344 CTACAATAACATATGAACCTAGG + Intronic
1174534740 20:51242395-51242417 CTACAAAACCATCTGGGTCTAGG + Intergenic
1174893837 20:54427753-54427775 CTACAAATAAACATGGATCTGGG + Intergenic
1179343856 21:40537926-40537948 CTCCAAAACCACATGGAAGGAGG - Intronic
1180082070 21:45491497-45491519 CTCCAACACCACATGGAGCTGGG - Intronic
1180703853 22:17796817-17796839 CTACACTACCACCTGGCCCTTGG + Intronic
1181305021 22:21911318-21911340 CTAAAAAACCACATGGGTATGGG - Intergenic
1183738884 22:39659204-39659226 GGACAAAGCCACCTGGACCTGGG + Intronic
950438141 3:12992950-12992972 CTACAAAACCACCTGCCCTTGGG - Intronic
950615867 3:14157774-14157796 CTCCAAAGCCACACAGACCTGGG + Intronic
950705907 3:14781458-14781480 CTGTAAAACCATATGGACCTGGG - Intergenic
950724917 3:14910966-14910988 CTAGAAAACCTCATAGAACTTGG - Intronic
951631668 3:24728409-24728431 CTAAAATACCACATGAACATTGG - Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
955688861 3:61570991-61571013 CACCAAAACCACAGAGACCTGGG + Intronic
956060139 3:65340821-65340843 CAACAAAACCAAATCCACCTTGG - Intergenic
956873810 3:73442885-73442907 AAACAACACCACAGGGACCTAGG - Intronic
958457120 3:94345819-94345841 CAATAAAAACACATGGACTTAGG + Intergenic
961608137 3:128113086-128113108 CTACAGAACCACCAGGAACTAGG + Intronic
962662217 3:137614333-137614355 CTACAAAGCAAAATGCACCTGGG + Intergenic
963967737 3:151391957-151391979 CTAAAAATTCACATGGACCGTGG - Intronic
964783660 3:160369939-160369961 TTAAGAAACCACATGCACCTGGG + Intronic
965441676 3:168722406-168722428 ATACATCACCACATGGAGCTAGG + Intergenic
965940819 3:174179281-174179303 CTACAGGTACACATGGACCTTGG - Intronic
967776960 3:193395018-193395040 CTGCAAAGCCACAGGGAGCTTGG - Intergenic
968629587 4:1643109-1643131 TTATAAAAGCACATGGCCCTCGG + Intronic
968677581 4:1892378-1892400 CTATAGGACCACATGGACCTTGG - Intronic
968876771 4:3272897-3272919 TTCCAACACCACATGGTCCTGGG + Intergenic
969882526 4:10186905-10186927 CTATAAAACCACCGTGACCTTGG + Intergenic
971206195 4:24571953-24571975 CTAGAAAACCACTTAAACCTAGG - Intronic
971266904 4:25103657-25103679 CTACAAAACCAACTGGCCCCAGG - Intergenic
973172925 4:47167517-47167539 CCTCAAAACCACCTGGCCCTGGG - Intronic
974814321 4:66985781-66985803 CTGTAAATCCACCTGGACCTGGG + Intergenic
975210133 4:71690320-71690342 TTGGAAAACCACATGGACATGGG - Intergenic
975783728 4:77866142-77866164 CTACAGAATCACTTGAACCTGGG - Intronic
976099600 4:81546982-81547004 CCAAAAAAGCACATGGATCTAGG + Intronic
977031230 4:91886633-91886655 CTTAATAACCACATGAACCTGGG - Intergenic
977678941 4:99777716-99777738 CTATAAAACCATCTGGTCCTGGG - Intergenic
980037236 4:127899433-127899455 CCACAAAAACACATGGACCTAGG - Intergenic
980319521 4:131251485-131251507 CCAGAGAAACACATGGACCTTGG + Intergenic
981378458 4:144043053-144043075 CTACAAAACAGCATGGTACTGGG + Intergenic
986482834 5:8205849-8205871 TTCCAAAACCACATGCAACTTGG + Intergenic
986757511 5:10851951-10851973 CTGTAAAACCACAGGGACCTGGG - Intergenic
991908462 5:71536540-71536562 CTAAAAAACAACATGGGCCCAGG + Intronic
994696360 5:103077355-103077377 CCACAAAACTACATGGAAATTGG - Intergenic
997997859 5:138600839-138600861 TTCCAAAACCACATGGTCCTGGG - Intergenic
1001793300 5:174480124-174480146 CCACAAAAACACATGGGCCCAGG + Intergenic
1003259427 6:4503572-4503594 CTAAAAAATCACGTGGACCCTGG - Intergenic
1010144129 6:72646492-72646514 CTGAAAAACCACATGGATTTGGG + Intronic
1011916621 6:92513858-92513880 CTATAAATCCACCTGGTCCTGGG - Intergenic
1012707368 6:102548672-102548694 CTACCAAAGCAGATGGTCCTTGG + Intergenic
1019297607 7:286568-286590 CCACATAGCCACCTGGACCTTGG - Intergenic
1020376202 7:7490308-7490330 CAACAGAACTACATGTACCTTGG + Intronic
1020500523 7:8913800-8913822 CCACAAAGCCACATGGCTCTCGG - Intergenic
1022289631 7:28988539-28988561 AAGCAAATCCACATGGACCTTGG + Intergenic
1027235753 7:76296808-76296830 CAAAAAAACCACATAGAACTGGG + Intergenic
1027476636 7:78640049-78640071 CTAAAAGACCATATGGATCTAGG - Intronic
1028785844 7:94792782-94792804 ATATATTACCACATGGACCTTGG + Intergenic
1031119382 7:117703879-117703901 CCACATAACAACATGCACCTGGG + Intronic
1031822038 7:126514281-126514303 CTATAAAACCACATAGAAATTGG - Intronic
1032453289 7:132052947-132052969 CTGCAGAGCCATATGGACCTTGG - Intergenic
1032860300 7:135871911-135871933 CTGTAAAACCATATGGGCCTGGG + Intergenic
1035377317 7:158413973-158413995 CTACTAAATCACTTGAACCTGGG + Intronic
1038180866 8:25226353-25226375 CAAGAAAACCACTTGAACCTGGG - Intronic
1042058392 8:64790470-64790492 CTACTAAAACACATTGATCTTGG - Intronic
1042851516 8:73221145-73221167 CTATAAATCCATCTGGACCTGGG + Intergenic
1044484609 8:92736849-92736871 CTACTGAACCAGATGGACCCTGG - Intergenic
1045411589 8:101926029-101926051 CACCAAAGCCACATGGAGCTGGG - Intronic
1049490513 8:142898038-142898060 CTAGAAAACCACAAGCTCCTAGG + Intronic
1051063255 9:13069965-13069987 CTACAAAACTACAGAGACCAAGG + Intergenic
1055633023 9:78243584-78243606 CTGCAAAAGCACATGCACCTAGG - Exonic
1058504330 9:105653280-105653302 CTCCCAGCCCACATGGACCTAGG - Intergenic
1060009906 9:120034513-120034535 CAACAAAAACACATGGACACAGG + Intergenic
1062689342 9:137833437-137833459 CCACGCAACCACAGGGACCTGGG - Intronic
1189045948 X:37591258-37591280 CTACTAAAGCACAAGGATCTTGG + Intronic
1190383153 X:49859055-49859077 TTAGAAAACCAAATGGAACTTGG - Intergenic
1192857710 X:75031432-75031454 CAACAAGAACACATGGACCAGGG - Intergenic
1193797599 X:85895442-85895464 CTACAAAGAAACATTGACCTGGG - Intronic
1194252122 X:91588664-91588686 CCACAAAACTACATGGAAATTGG + Intergenic
1194649415 X:96497811-96497833 CTCCAAAATCCTATGGACCTGGG - Intergenic
1197114965 X:122820750-122820772 CCACACAACCACATGGAAATTGG + Intergenic
1198391232 X:136176618-136176640 CTACAAAACCAAACAGAACTAGG - Intronic
1200571051 Y:4829904-4829926 CCACAAAACTACATGGAAATTGG + Intergenic