ID: 1094359197

View in Genome Browser
Species Human (GRCh38)
Location 12:29611787-29611809
Sequence TGTTTCACACAGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094359197 Original CRISPR TGTTTCACACAGATGGGGCA GGG Intronic
900322539 1:2092263-2092285 CTCTTCACACAGAGGGGGCAGGG - Intronic
906264916 1:44421469-44421491 TGACACACACAGATGGGGGAAGG - Intronic
906378742 1:45317971-45317993 GGGTTCACACAGACAGGGCACGG - Intergenic
908389303 1:63670506-63670528 TGTTTCTCACAGATGCCTCAAGG + Intergenic
908495705 1:64692363-64692385 TGTTTGACAGAGATGGGGAGGGG + Exonic
909014728 1:70369730-70369752 GGTCCCACACAGATGGGACATGG - Intronic
909550998 1:76898149-76898171 GGTCTCACACAGATGGGATACGG + Intronic
910049405 1:82957651-82957673 GGTCGCACACAGATGGGGCGCGG - Intergenic
910292852 1:85616146-85616168 GGTTCCACAAAGCTGGGGCACGG - Intergenic
912073615 1:105844708-105844730 AGTTGCACAAAGATGTGGCATGG - Intergenic
913159237 1:116130329-116130351 TGTGCCACACAGGTGGGTCAGGG - Intronic
913203406 1:116514267-116514289 TGTATAACACAGGTGGGGCAGGG - Intergenic
914826665 1:151142463-151142485 TTGTTCACAGAGATGGGGCAAGG + Intronic
915205799 1:154269605-154269627 TGTTTTCCACAGCTGGGGAAGGG - Intronic
916122763 1:161543425-161543447 TGTTTGACAGAGATGTGACAGGG + Intronic
916132661 1:161624865-161624887 TGTTTGACAGAGATGTGACAGGG + Intronic
918460141 1:184767995-184768017 TTTTTTCCACGGATGGGGCAGGG - Intergenic
920661761 1:207921443-207921465 TGTTACCCACAGTTGGGGGAGGG + Intergenic
922934847 1:229414719-229414741 GGTCCCACACAGATGGGACATGG - Intergenic
924095811 1:240549732-240549754 TGTGTCACACAGAGTTGGCAAGG + Intronic
1063106386 10:2996357-2996379 GGTCCCACACAGATGGGACATGG + Intergenic
1064117462 10:12591137-12591159 TGTTAGACACAGAGGGGTCAGGG + Intronic
1064981577 10:21172272-21172294 TGTGTCACCCAGGTGTGGCAGGG - Intronic
1068058326 10:52037141-52037163 GGTCCCACACAGATGGGACACGG + Intronic
1068179636 10:53502412-53502434 GGTCCCACACAGATGGGACACGG + Intergenic
1068360794 10:55973535-55973557 GGTCCCACACAGATGGGACATGG - Intergenic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1069632945 10:69908573-69908595 TGATTCATCCAGAAGGGGCATGG + Intronic
1069896470 10:71683249-71683271 TGTCTCCCACAGATGGGGAGGGG - Intronic
1070094033 10:73318952-73318974 TGTTTTACTGAGATGGAGCAAGG + Intronic
1070350892 10:75591352-75591374 AGTTAAAAACAGATGGGGCAAGG + Intronic
1070722098 10:78764065-78764087 TTATCCACACAGATGGGGCTGGG - Intergenic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1073920513 10:108452836-108452858 TGATTCATACACATGGGTCAGGG + Intergenic
1074973584 10:118563667-118563689 TGATTCAAACAGCTGGGGCGGGG - Intergenic
1076858727 10:133129705-133129727 TCTTTCACAAGGAAGGGGCAGGG - Exonic
1077532915 11:3105695-3105717 GGCTTCACAGAGGTGGGGCAGGG - Intronic
1077589859 11:3483011-3483033 GGTCCCACACAGATGGGACATGG + Intergenic
1077679046 11:4222622-4222644 GGTCTCGCACAGATGGGACACGG + Intergenic
1077688482 11:4319263-4319285 GGTCTCGCACAGATGGGACACGG + Intergenic
1078042563 11:7882365-7882387 TGTTCCACTCAGTTGGGGCCGGG - Intergenic
1080027893 11:27632461-27632483 GGTCCCACACAGATGGGACACGG + Intergenic
1082714375 11:56593788-56593810 TGTTTCCCACAGATTGGGATTGG - Intergenic
1083562367 11:63682697-63682719 TCTTTCACAGAGATGGGAGAAGG - Intronic
1083726691 11:64632108-64632130 GGTGGCTCACAGATGGGGCAAGG + Intronic
1084448260 11:69216890-69216912 TGTCTCACACAGCCAGGGCAAGG - Intergenic
1084827112 11:71739793-71739815 GGTCCCACACAGATGGGACATGG - Intergenic
1085217855 11:74848187-74848209 TGTGTCACTCAGGTGGGACAGGG + Exonic
1085654123 11:78296888-78296910 TGTTTCTAACAGATGGTGGAGGG + Intronic
1085769450 11:79311818-79311840 TGTTTCACACAGGTGGGCAGGGG - Intronic
1086135490 11:83439904-83439926 GGTTTCACACATCTGAGGCATGG - Intergenic
1087307925 11:96506100-96506122 TGTTTCACACAGAAGAGACTTGG - Intronic
1087450323 11:98312935-98312957 TGTTTAATACAGGTGGGCCAAGG + Intergenic
1087981616 11:104620906-104620928 AGTTTCACACAACTGTGGCAGGG + Intergenic
1088688375 11:112304252-112304274 TGTTACAGGCATATGGGGCAGGG + Intergenic
1089290899 11:117437532-117437554 TGTTTGGCACAGATGGGGTGGGG + Intronic
1089867024 11:121641301-121641323 GGTCCCACACAGATGGGACACGG + Intergenic
1090532694 11:127607669-127607691 TTTTTCACAAAGGCGGGGCAAGG - Intergenic
1091891223 12:4056151-4056173 TGCATCACCCAGTTGGGGCAGGG + Intergenic
1093267986 12:17025081-17025103 GGTCCCACACAGATGGGACATGG + Intergenic
1093302253 12:17471884-17471906 GGTCCCACACAGATGGGACACGG - Intergenic
1093414174 12:18901319-18901341 TGTTAAAAACAGTTGGGGCAAGG + Intergenic
1093578838 12:20765711-20765733 GGTCCCACACAGATGGGACATGG - Intergenic
1093584496 12:20820379-20820401 GGTCCCACACAGATGGGACACGG + Intronic
1093792542 12:23270365-23270387 AGATTCACACAGATGGGTGATGG + Intergenic
1094316028 12:29138379-29138401 GGTCCCACACAGATGGGTCATGG + Intergenic
1094359197 12:29611787-29611809 TGTTTCACACAGATGGGGCAGGG + Intronic
1094400701 12:30058312-30058334 GGTCCCACACAGATGGGACATGG - Intergenic
1095637676 12:44452131-44452153 GGTCCCACACAGATGGGACATGG - Intergenic
1095681842 12:44986631-44986653 TTTTTCACAGAGATGGGGTTGGG + Intergenic
1095778161 12:46032193-46032215 GGTCCCACACAGATGGGACACGG - Intergenic
1097316119 12:58173152-58173174 TGTCTCACACAGATGTGCAAAGG + Intergenic
1097324950 12:58266030-58266052 TATTTCACACAGAGTGGTCAAGG + Intergenic
1097398611 12:59104174-59104196 TGTCCCGCACAGATGGGACACGG - Intergenic
1099188739 12:79542194-79542216 GGTCCCACACAGATGGGACACGG - Intergenic
1099648894 12:85398743-85398765 TGTTTGACACAACTGGGGGAGGG + Intergenic
1099673473 12:85726202-85726224 TGGTTGTCACAGATGGGGTAAGG - Intergenic
1100411793 12:94326187-94326209 TGGCTCACACAGAGAGGGCATGG + Intronic
1100446180 12:94662109-94662131 TGCTCCACACTGATGGGCCAAGG - Intergenic
1101077428 12:101145812-101145834 GGTCCCACACAGATGGGACATGG - Intergenic
1101143588 12:101820609-101820631 TGGTTGATACAGCTGGGGCATGG - Intronic
1102404680 12:112663150-112663172 TGTTTCACTCAGATCAGGCTTGG - Intronic
1102688553 12:114742610-114742632 GGACCCACACAGATGGGGCAGGG + Intergenic
1104048964 12:125183925-125183947 AGAGTCACACAGCTGGGGCATGG + Intergenic
1104912984 12:132248778-132248800 GATTTCACAGAGATGGGGCCAGG - Intronic
1106934101 13:34699296-34699318 TGTTTCACACAGATGTTGATTGG + Intergenic
1107707517 13:43122457-43122479 TGTTTCACACAAAAGGTGCCAGG + Intergenic
1107861768 13:44667619-44667641 TGGCTCTCACAGATGGGGCAGGG + Intergenic
1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG + Intergenic
1108919523 13:55658351-55658373 GGTCCCACACAGATGGGACACGG + Intergenic
1110656746 13:78009011-78009033 TATTTAACATAGATGAGGCAGGG + Intergenic
1110845366 13:80186007-80186029 GGTCCCACACAGATGGGACATGG - Intergenic
1111458815 13:88516202-88516224 GGTCCCACACAGATGGGACAAGG + Intergenic
1111849913 13:93560138-93560160 TGTTTCATTCAGATGAGGAAAGG - Intronic
1112857999 13:103794385-103794407 TGCTTCTAACAGATGGAGCAGGG - Intergenic
1113147056 13:107218759-107218781 TGTCACACAAAGATGGGGAATGG + Intronic
1113566876 13:111324608-111324630 CGTTTCACAGAGAGAGGGCAAGG + Intronic
1116390342 14:44383914-44383936 TGTTTTACACACTGGGGGCATGG - Intergenic
1116573476 14:46546262-46546284 GGTCCCACACAGATGGGACATGG - Intergenic
1117582417 14:57165471-57165493 TCTTTCACACAGTTGGTGGAAGG + Intergenic
1122381299 14:101309048-101309070 GGTCCCACACAGATGGGACACGG + Intergenic
1127337875 15:58008102-58008124 TGTCTCAAACAGATGAGGGAAGG - Intronic
1129364644 15:75046853-75046875 TGTTTAGCACAAATGGGCCAGGG - Intronic
1130296277 15:82648582-82648604 AGTTTCACAGAAATAGGGCAAGG + Intronic
1130304571 15:82704587-82704609 GGTTCCACACAGATGGGACAAGG - Intronic
1130513474 15:84607838-84607860 TTTATCACAGAGATGGGACAAGG - Intronic
1135025391 16:18995506-18995528 GGTCCCACACAGATGGGACACGG + Intronic
1136995492 16:35186006-35186028 TGTCCCTCACAGGTGGGGCAGGG - Intergenic
1138310703 16:56021238-56021260 TGTTTTAATCAGATGGGGTATGG + Intergenic
1141604234 16:85143895-85143917 TGTCTCTCACAGATGGGCCACGG - Intergenic
1141848206 16:86625770-86625792 TGTTTTACACAGATGAAGAAAGG + Intergenic
1141851380 16:86648527-86648549 TGTTGCCCACAGAAGGGGCCTGG - Intergenic
1143847206 17:9781560-9781582 TGTTCCACACAGGTGGGGCAAGG - Exonic
1143882032 17:10037002-10037024 GGGTTCACACAGCTGGGGCCGGG - Intronic
1144130564 17:12242747-12242769 TCTTTGACACTGATGGAGCAGGG + Intergenic
1146006334 17:29162990-29163012 TCCTGCACACAGATGGGGCCAGG - Intronic
1148774672 17:50088651-50088673 TGGTTTACAGAGATGGGGCCTGG - Intronic
1150721322 17:67616571-67616593 TATTTCACCCAGATGAGCCAGGG + Intronic
1152088898 17:78236311-78236333 GGTTTGGCACAGATGAGGCAGGG + Intronic
1152422718 17:80202785-80202807 TGGTTGTCACAGCTGGGGCATGG - Intronic
1155263953 18:24073415-24073437 TGTTCCACACTGAGAGGGCAAGG - Intronic
1155930901 18:31707179-31707201 CATTTCTCACAGATAGGGCATGG - Intergenic
1155992068 18:32287989-32288011 TGATTCATACAAATGAGGCACGG + Exonic
1156302271 18:35846230-35846252 GGTCCCACACAGATGGGACATGG - Intergenic
1160223369 18:76992959-76992981 GGTTTCAGACAGATGGGAGAAGG - Intronic
1162141320 19:8587020-8587042 TGGTTCACAAGGGTGGGGCAGGG - Intronic
1162569905 19:11465760-11465782 CGTTGCACAAAGATGGGGGATGG + Intronic
1162883397 19:13677607-13677629 TGTTTCACCAAGATGGGCCTAGG - Intergenic
1162905674 19:13822122-13822144 TGTTTTAAAGAGATGGGCCAAGG - Intronic
1163772911 19:19201633-19201655 TGTTGCACTGAGATGGGGCAGGG - Exonic
1164202481 19:23030194-23030216 GGTCCCACACAGATGGGACATGG + Intergenic
1164560953 19:29291891-29291913 TGTTTCATACCGAAGGGTCAGGG - Intergenic
1165059001 19:33195703-33195725 AGGCTCACACAGCTGGGGCAAGG - Intronic
1165249258 19:34516330-34516352 GGTCCCACACAGATGGGACATGG - Intergenic
1167086158 19:47311029-47311051 TCTTTGACACAGATGAAGCAAGG - Intronic
1167514390 19:49914621-49914643 TGGTTCTCACAGATGGGGGTGGG - Intronic
1167902172 19:52630108-52630130 GGTCCCACACAGATGGGACACGG - Intronic
925247228 2:2394743-2394765 TGCTTCACAGAGAAGGGGAAGGG - Intergenic
925989938 2:9246578-9246600 ATTTTCACACAGGTGGGGCTGGG - Intronic
927811779 2:26184488-26184510 TGGTTCATGCAGATGAGGCAGGG - Exonic
928228505 2:29475980-29476002 TGCTTCGGACAGATGGGGCAGGG + Intronic
928506501 2:31958943-31958965 TGTTTAACACAGTTTGGGCTGGG - Intronic
929056372 2:37880392-37880414 TGTTTCACATAGAAGGAACATGG + Intergenic
929076654 2:38084139-38084161 GGTCCCACACAGATGGGACATGG + Intronic
929684505 2:44022417-44022439 GGTCCCACACAGATGGGACACGG + Intergenic
930487342 2:52025487-52025509 GGTCCCACACAGATGGGACACGG + Intergenic
930505807 2:52281729-52281751 TGTTTTTGACAGATGGGGCAGGG + Intergenic
930955119 2:57195303-57195325 GGTCCCACACAGATGGGACACGG - Intergenic
931625801 2:64254865-64254887 GGTCCCACACAGATGGGACACGG - Intergenic
932159438 2:69447025-69447047 GGTCCCACACAGATGGGACATGG + Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
934527432 2:95060258-95060280 TGTTTGTCCAAGATGGGGCACGG - Intergenic
935199135 2:100840724-100840746 AGTTTCACAGTGGTGGGGCAGGG + Intronic
935699964 2:105802802-105802824 TGTGTCACATACATGGGCCATGG + Intronic
938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG + Intergenic
939421252 2:141972704-141972726 TGTTTAAAACAGATGGGTCTAGG - Intronic
940216846 2:151311167-151311189 GGTCCCACACAGATGGGACATGG - Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
941284345 2:163590948-163590970 TGTTTCACAGAGATTTTGCATGG - Intergenic
945143624 2:206714022-206714044 TGATTCAAACATATGTGGCAAGG + Intronic
945173482 2:207019584-207019606 GGTCCCACACAGATGGGACATGG - Intergenic
945554708 2:211263805-211263827 GGTTCCACACAGATGGGACACGG - Intergenic
945605992 2:211931793-211931815 CGTTTTACATAGATGTGGCAAGG + Intronic
946064274 2:216973349-216973371 TGTTTCTCACAGGTGAGGCTGGG - Intergenic
946781023 2:223193214-223193236 GGTCCCACACAGATGGGACATGG + Intronic
947413268 2:229866082-229866104 TGTTTGAAATACATGGGGCATGG - Intronic
948180118 2:235972942-235972964 TGTCGCACACAGCTGGGGAAGGG - Intronic
948720774 2:239898772-239898794 AGTCCTACACAGATGGGGCAAGG + Intronic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1169568061 20:6877211-6877233 TGTTTCAGAAAGAGGGAGCATGG - Intergenic
1173101936 20:40095685-40095707 GGTCCCACACAGATGGGACACGG - Intergenic
1173873077 20:46353754-46353776 GGTTTTGCAGAGATGGGGCATGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1179164622 21:38925791-38925813 TGGTTGGCACAAATGGGGCAGGG + Intergenic
1179219749 21:39395741-39395763 TGTTTGACACAGCTGGGCCTAGG + Intronic
1181951221 22:26555177-26555199 TGTTTCACAGAGAGGGAGCAAGG - Intronic
1182908588 22:33959992-33960014 TGTTTCAAACAGCGTGGGCAAGG - Intergenic
1183941982 22:41301246-41301268 CTTTTGACACAGATGGGGAAGGG + Intergenic
950225094 3:11226943-11226965 TGTATCACACATGTGGGGCCAGG + Intronic
951402559 3:22251633-22251655 TGGTTCTCACAAATGGGGGAGGG - Intronic
951709759 3:25576114-25576136 GGTTTCACAGGGATGGGGCTGGG + Intronic
953352882 3:42229483-42229505 TGTGGCCCACAGATGGGGAAAGG - Intergenic
953599419 3:44348396-44348418 GGTCCCACACAGATGGGACACGG + Intronic
954883669 3:53853558-53853580 TGTGTCACAAAGCTGGGGCAAGG - Intronic
955071918 3:55578788-55578810 TCTTTCACACATTTGGGGCTTGG + Intronic
955142680 3:56285208-56285230 AGTTTCAAGCAGATGGGGCTAGG + Intronic
956057417 3:65315072-65315094 TGTTTAACACAGGTGGCACAAGG + Intergenic
956709237 3:72025325-72025347 GGTCCCACACAGATGGGACATGG - Intergenic
957059877 3:75473405-75473427 GGTCCCACACAGATGGGACATGG + Intergenic
958751020 3:98193336-98193358 GGTCCCACACAGATGGGACACGG - Intronic
961183500 3:124895046-124895068 TGTTCTACACAGATGTGGCTTGG + Intronic
961293528 3:125866032-125866054 GGTCCCACACAGATGGGACATGG - Intergenic
961567763 3:127775899-127775921 AGTCTCACCCAGAGGGGGCAAGG - Intronic
961711604 3:128832565-128832587 GGTCCCACACAGATGGGACACGG + Intergenic
963111819 3:141694660-141694682 GGTCCCACACAGATGGGACATGG + Intergenic
963319766 3:143799619-143799641 GGTCCCACACAGATGGGACATGG - Intronic
963343181 3:144062341-144062363 TGTCTAACTCAGATGGGGAAAGG + Intergenic
963456645 3:145554549-145554571 GGTCTCGCACAGATGGGACACGG + Intergenic
963663363 3:148153987-148154009 GGTCCCACACAGATGGGACATGG - Intergenic
963776192 3:149443823-149443845 TGTTTAACACTGATATGGCAAGG + Intergenic
967861750 3:194157287-194157309 TGTGTCACATAAAGGGGGCAGGG - Intergenic
968079760 3:195837735-195837757 TGCCTCACGGAGATGGGGCATGG + Intergenic
968584392 4:1409356-1409378 TGTTCCTCAGAGATGGGGGAGGG - Intergenic
970396455 4:15672196-15672218 GGTTTCCCACAGCTGAGGCAAGG + Intronic
970532757 4:16999998-17000020 GGTCCCACACAGATGGGACATGG - Intergenic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
971230653 4:24798446-24798468 TGGTGCACACAGAGGAGGCATGG - Intronic
971744188 4:30558132-30558154 AGTTTCACAAATATGAGGCAGGG - Intergenic
973874512 4:55203473-55203495 TGTATCACACACAGTGGGCAAGG + Intergenic
974693963 4:65340462-65340484 TCTTTCTCACAGTGGGGGCAGGG + Intronic
975611236 4:76205776-76205798 TGTTTAACAGAAATGGGGGAGGG - Intronic
976164032 4:82234491-82234513 ACTTTCACACAGAGGGGGCAAGG + Intergenic
976739936 4:88347125-88347147 GGTCCCACACAGATGGGACATGG + Intergenic
977062491 4:92274868-92274890 GGTCCCACACAGATGGGACACGG + Intergenic
978303211 4:107293798-107293820 GGTCCCACACAGATGGGACATGG + Intergenic
978438629 4:108711360-108711382 GGTCCCACACAGATGGGACATGG - Intergenic
979146637 4:117254433-117254455 GGCTCCACACAGATGGGACATGG - Intergenic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
980250689 4:130310612-130310634 TGTTTCACTCAGCTGGTACATGG - Intergenic
981040263 4:140215827-140215849 GGTCCCACACAGATGGGACATGG - Intergenic
981482709 4:145254923-145254945 GGTCCCACACAGATGGGACATGG + Intergenic
982197385 4:152930049-152930071 TGTTTCACACAGTTGGGGGCAGG - Intergenic
982535466 4:156602615-156602637 GGTCCCACACAGATGGGACATGG - Intergenic
983023891 4:162711434-162711456 GGTCCCACACAGATGGGACATGG - Intergenic
983345577 4:166522855-166522877 GGTCCCACACAGATGGGACATGG - Intergenic
984519906 4:180788780-180788802 TGTTTCACACAGAAAGGTCAAGG + Intergenic
985776427 5:1846489-1846511 GGTTTCACAAAGAGGGGGCTGGG + Intergenic
985795359 5:1958110-1958132 TGTTGCACACCTTTGGGGCAGGG + Intergenic
986919570 5:12665917-12665939 GGTCTCACACAGATGGGACGCGG + Intergenic
986981174 5:13449602-13449624 AGTTTCAGACAGATTGGACAGGG - Intergenic
988235781 5:28542185-28542207 TTGTTCACACAGAGGAGGCAAGG + Intergenic
989192628 5:38686125-38686147 TGTTTCACGAAGATGCAGCAAGG + Intergenic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
992008270 5:72500704-72500726 TGTTGCACACAGATTGATCAGGG - Intronic
994560778 5:101368361-101368383 GTTTTCAGACAGATGGGGGAGGG - Intergenic
994775702 5:104033950-104033972 GGTCCCACACAGATGGGACATGG - Intergenic
994793694 5:104265688-104265710 TGTTACTCACAGCTGGGGAAGGG - Intergenic
995125143 5:108571834-108571856 GGTCTCGCACAGATGGGACACGG + Intergenic
995143752 5:108763358-108763380 TTTGTCACAGAGATGGGGCAGGG - Intronic
997746421 5:136303646-136303668 GGTCCCACACAGATGGGACACGG - Intronic
999497652 5:152115855-152115877 TGTGGCCCACAGAGGGGGCAGGG - Intergenic
999734022 5:154499164-154499186 GGTTTCTCACAGCTGGGGCAGGG - Intergenic
999845056 5:155470187-155470209 TGTTTCTCACAGATAAGGAATGG + Intergenic
1000184319 5:158844060-158844082 AGTTTCCCACAGTTGGGGTAAGG - Intronic
1000885300 5:166742469-166742491 GGTCCCACACAGATGGGACACGG + Intergenic
1000935622 5:167301265-167301287 GGTCCCACACAGATGGGACATGG + Intronic
1001591068 5:172865747-172865769 TGAATCCCACAGATGGGACATGG - Intronic
1004797115 6:19099085-19099107 TGTTTCACCCCTATGGGACATGG - Intergenic
1006967734 6:38006550-38006572 TGTATAACACAGAGTGGGCAGGG + Intronic
1007173859 6:39883241-39883263 TCCTACACAGAGATGGGGCAAGG + Intronic
1007832692 6:44650905-44650927 TGTTTGTCACAGATGGGACAGGG + Intergenic
1008393468 6:50979773-50979795 TGTTTCACCTAGGTGGTGCATGG + Intergenic
1008476547 6:51940516-51940538 GGTCCCACACAGATGGGGCATGG - Intronic
1011497310 6:87949425-87949447 TGTTTGTCACAACTGGGGCAGGG + Intergenic
1012596223 6:101043813-101043835 TGTTTCACACAGATTGTGAGTGG + Intergenic
1015176362 6:130313373-130313395 TGTTTCACACACCTGGTGTATGG - Intronic
1015271393 6:131341213-131341235 GGTCCCACACAGATGGGACACGG - Intergenic
1017591619 6:155984342-155984364 TATTTCACAGAGATATGGCAGGG - Intergenic
1017706991 6:157132604-157132626 TGCATCCCACAGATTGGGCAGGG + Intronic
1018042883 6:159940664-159940686 AGTTTGACTCAGATCGGGCATGG + Intergenic
1018056486 6:160056610-160056632 TGATTCAGAAAGAAGGGGCAGGG - Intronic
1018067763 6:160135602-160135624 TGTTTCACAAGGACGAGGCAGGG - Intronic
1018211533 6:161487352-161487374 TGGCTCACACAGATGGGCGAAGG - Intronic
1018587364 6:165376454-165376476 TGTTTGACAAAGCAGGGGCAGGG + Intronic
1019869048 7:3741424-3741446 AGCTTCACACAGATATGGCATGG - Intronic
1022318843 7:29268842-29268864 TGATTCACTCAAATGGGCCACGG + Intronic
1022710028 7:32841281-32841303 GGTCCCACACAGATGGGACACGG + Intergenic
1024391368 7:48816672-48816694 TGTTCCACTCATGTGGGGCAAGG - Intergenic
1024739233 7:52337023-52337045 GGTCCCACACAGATGGGACATGG + Intergenic
1025983391 7:66426518-66426540 TCTTTCACCCAGGTAGGGCATGG - Intergenic
1026448345 7:70505510-70505532 TGTTTAATTCAGATGGGGCCAGG - Intronic
1026912641 7:74100231-74100253 TGTCTCAAAAAAATGGGGCAGGG + Intronic
1027157906 7:75781485-75781507 GGTCCCACACAGATGGGACAAGG - Intronic
1028670529 7:93396263-93396285 GGTCCCACACAGATGGGTCACGG - Intergenic
1028690196 7:93642193-93642215 GGTCCCACACAGATGGGACATGG - Intronic
1029179155 7:98687386-98687408 GCTTTCACACGGCTGGGGCATGG - Intergenic
1029724163 7:102391091-102391113 TGACTCACACAGATGGGACAGGG - Intronic
1030113131 7:106043130-106043152 TGTTTCACACAGTTGGAGGGTGG - Intergenic
1030740280 7:113101302-113101324 TGTTTCACAGAGGTTAGGCAGGG - Intergenic
1031004687 7:116457816-116457838 GGTCTCACACAGATGGGACGCGG - Intronic
1031776343 7:125912321-125912343 GGTCCCACACAGATGGGACACGG - Intergenic
1032351198 7:131165496-131165518 TGTTTTACACAGAAGGTGTAGGG + Intronic
1033084736 7:138331361-138331383 GGTCCCACACAGATGGGACATGG - Intergenic
1033663322 7:143418691-143418713 TGCAGAACACAGATGGGGCAAGG + Intergenic
1034842341 7:154410997-154411019 TTTTTCACGGAGTTGGGGCAGGG - Intronic
1036147839 8:6270857-6270879 GGCTCCACACAGGTGGGGCACGG + Intergenic
1036372148 8:8170939-8170961 GGTCTCGCACAGATGGGACATGG - Intergenic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG + Exonic
1036878753 8:12494702-12494724 GGTCTCGCACAGATGGGACATGG + Intergenic
1037635647 8:20699463-20699485 TGTTCCACACACATGTGGCCAGG + Intergenic
1038581292 8:28751433-28751455 TGCTGCACACAGATGGCGCTGGG - Exonic
1043597436 8:81901915-81901937 GGTCCCACACAGATGGGACATGG + Intergenic
1043946601 8:86260861-86260883 TGTTTCTCACAGATAAGGAATGG + Intronic
1044922012 8:97177407-97177429 GGTCCCACACAGATGGGACATGG - Intergenic
1045556605 8:103220317-103220339 TGTCTCTCAGGGATGGGGCAAGG + Intronic
1046294137 8:112198155-112198177 GGTTCCACAAAGATGGGACATGG - Intergenic
1047699367 8:127434060-127434082 GGTCCCACACAGATGGGACACGG - Intergenic
1048770974 8:137894752-137894774 TGTTTCACTCAGATGGTGGCTGG + Intergenic
1049197472 8:141323675-141323697 TGTGTCAGACAAAAGGGGCAGGG - Intergenic
1050032965 9:1405642-1405664 TGTTTCACACAGATGGTGGAAGG - Intergenic
1051052644 9:12950654-12950676 GGTCCCACACAGATGGGACATGG - Intergenic
1051788621 9:20774141-20774163 TTTTCCACACACCTGGGGCAGGG - Intronic
1053059902 9:35022684-35022706 GGTCCCACACAGATGGGACACGG + Intergenic
1053078443 9:35154610-35154632 GGTCTCATACAGATGGGACACGG + Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056323907 9:85460979-85461001 GGTCCCACACAGATGGGACACGG - Intergenic
1056363729 9:85883018-85883040 TGTCCCGCACAGATGGGACATGG - Intergenic
1057684020 9:97217176-97217198 GGTCCCACACAGATGGGACATGG - Intergenic
1057715204 9:97488284-97488306 TGTGTTCCACATATGGGGCAAGG - Intronic
1057847697 9:98538321-98538343 TCTTTCATCCAGAGGGGGCATGG + Intronic
1057985245 9:99706807-99706829 TGTTTCAGAGAATTGGGGCAAGG - Intergenic
1058429796 9:104907908-104907930 TGTTTCATACAGTTTGGGCATGG + Intronic
1058475648 9:105329812-105329834 TTTTCCAGACAGATGGGGAAGGG - Intronic
1062491303 9:136806344-136806366 TGTGTCCCACAGAGGGGCCAGGG + Intronic
1186086727 X:5998510-5998532 TGTTTCATACACATGGTGCTAGG - Intronic
1186444204 X:9612178-9612200 TGTTTCACACTGGTCGGGGAGGG + Intronic
1189732334 X:44034270-44034292 AGTTTCACAGAGAGGGGACATGG + Intergenic
1191104336 X:56763321-56763343 GGTTTCACACAGATGGGGGTGGG - Intergenic
1192093961 X:68190389-68190411 AGTTTCATACATTTGGGGCAGGG + Intronic
1195841505 X:109180755-109180777 GGTCCCACACAGATGGGACATGG - Intergenic
1196341698 X:114604678-114604700 GGTCCCACACAGATGGGACACGG + Intronic
1197499741 X:127228934-127228956 GGTCCCACACAGATGGGACACGG - Intergenic
1197793655 X:130279369-130279391 GGTCCCACACAGATGGGACATGG - Intergenic
1198983736 X:142426941-142426963 GGTCCCACACAGATGGGACACGG + Intergenic
1199300370 X:146206218-146206240 TGTTTCACACAGAAGGGAATGGG + Intergenic
1199576498 X:149318000-149318022 GGTCCCACACAGATGGGACATGG - Intergenic
1200183560 X:154166924-154166946 TGTTACAAATAGGTGGGGCACGG + Intergenic
1200189214 X:154204052-154204074 TGTTACAAATAGGTGGGGCACGG + Intergenic
1200194969 X:154241861-154241883 TGTTACAAATAGGTGGGGCACGG + Intergenic
1200200619 X:154278982-154279004 TGTTACAAATAGGTGGGGCACGG + Intronic
1202258544 Y:22944993-22945015 TGTGTCCCACAGCTGGGGAAGGG + Intergenic
1202411533 Y:24578751-24578773 TGTGTCCCACAGCTGGGGAAGGG + Intergenic
1202459249 Y:25091321-25091343 TGTGTCCCACAGCTGGGGAAGGG - Intergenic