ID: 1094360226

View in Genome Browser
Species Human (GRCh38)
Location 12:29622610-29622632
Sequence GGGAATGCATGTACAGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094360226_1094360230 5 Left 1094360226 12:29622610-29622632 CCTTTAACTGTACATGCATTCCC 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1094360230 12:29622638-29622660 GTGATTACCCTCATCACAAAGGG 0: 1
1: 0
2: 1
3: 24
4: 106
1094360226_1094360229 4 Left 1094360226 12:29622610-29622632 CCTTTAACTGTACATGCATTCCC 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1094360229 12:29622637-29622659 AGTGATTACCCTCATCACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094360226 Original CRISPR GGGAATGCATGTACAGTTAA AGG (reversed) Intronic
901393155 1:8961016-8961038 GGGAATGACAGTACAATTAATGG + Intronic
902633938 1:17722826-17722848 AGGAATTCATGTTCAGATAATGG + Intergenic
904505950 1:30954188-30954210 GGGAATGCTTTTACCGTTGATGG + Intronic
904950824 1:34237303-34237325 GGGAATGAATGCACAGCTACAGG + Intergenic
905324065 1:37137937-37137959 AGCAATGCATCTAGAGTTAAAGG - Intergenic
908089710 1:60673023-60673045 TGCAATGTAGGTACAGTTAATGG - Intergenic
909509453 1:76435273-76435295 GAGAATACATATAAAGTTAAAGG + Intronic
914266559 1:146042994-146043016 GTTTATGCATATACAGTTAAAGG - Intergenic
917229632 1:172822248-172822270 GGGACAGCATGTACAGTTGTGGG - Intergenic
919278951 1:195461557-195461579 GGTAATACATGTACAGATGAAGG - Intergenic
1063094973 10:2900936-2900958 CCTAATGCATGGACAGTTAAGGG - Intergenic
1063723742 10:8613927-8613949 GGGAATGCCTATACAGTGACTGG + Intergenic
1063773240 10:9228497-9228519 GGCAATGAATGTACTGTTAACGG + Intergenic
1065310490 10:24411443-24411465 GGGAATGTAAGTACAATAAAAGG - Intronic
1065906148 10:30254345-30254367 GGAAATGCATGTCCATTTATTGG - Intergenic
1067817625 10:49494499-49494521 GGGAATGCATGTTGAGACAATGG - Intronic
1072677330 10:97477848-97477870 GGAAGTGCATGTACAGGTGAGGG - Exonic
1073831273 10:107386128-107386150 GGGACTGCATGTACAGAAAAGGG - Intergenic
1074077935 10:110146149-110146171 GGGAAAGTATGTATAGTAAATGG + Intergenic
1076078866 10:127559790-127559812 GAGAATGAATGCACAGTGAAGGG + Intergenic
1079403326 11:20124313-20124335 GGAAATGCATGGAAACTTAATGG + Intergenic
1080018521 11:27533515-27533537 GGGAAAGAATGTACAATTTATGG - Intergenic
1081569722 11:44282093-44282115 GGGAATGCTGGAACAGTAAAAGG + Intronic
1082299956 11:50493560-50493582 GGAAATGCATGTGTAGATAAGGG + Intergenic
1084672038 11:70612736-70612758 GGGAATCCATGTATTGTTTAAGG - Intronic
1087321566 11:96666515-96666537 GGGTATCCATGTAAAGGTAAGGG + Intergenic
1091067867 11:132533729-132533751 GGAATTGTATGTACAATTAAAGG - Intronic
1094360226 12:29622610-29622632 GGGAATGCATGTACAGTTAAAGG - Intronic
1106075815 13:26459967-26459989 GGGAATGAATGTACATTCAGAGG - Intergenic
1107485573 13:40823796-40823818 TGTAATGCATATACATTTAATGG - Intergenic
1110311738 13:74057856-74057878 GTCAAAGCATGTACAGTGAAGGG + Intronic
1111001879 13:82195352-82195374 GGGAACACTTGTACAGTTAGTGG + Intergenic
1114968695 14:27999157-27999179 GTTAATTCATTTACAGTTAATGG - Intergenic
1118138659 14:63055605-63055627 AGCAATGCATGAACAGCTAATGG - Intronic
1118344277 14:64924880-64924902 AGGAATAAATGTACAGGTAATGG + Intronic
1120911891 14:89674366-89674388 GCTAATGCATGTACAATAAAGGG + Intergenic
1121983257 14:98473775-98473797 GGGAATGAATGGTTAGTTAATGG - Intergenic
1125865816 15:43047707-43047729 TGGAAAGCATGTACAGTTGTTGG - Intronic
1126119466 15:45238934-45238956 GGGAATGCAGGTTCAGGAAAGGG - Intergenic
1126417559 15:48433580-48433602 GGGAATGAGTTTACTGTTAATGG + Intronic
1136488364 16:30587794-30587816 GGGGATGCTGGTACAGTTATTGG + Intergenic
1146749563 17:35365949-35365971 AGCATTGTATGTACAGTTAAAGG - Intronic
1163883094 19:19944575-19944597 GGGAATGCAGAGACAGTCAAGGG - Intergenic
1164378538 19:27711241-27711263 GGAAAAGCATGTGCAGTTAAGGG + Intergenic
1164967361 19:32496989-32497011 GGGAATACATGTCCAGTACAAGG + Intergenic
1165022741 19:32937241-32937263 GGGAAGGCAGGTGCAGTTATGGG - Intronic
926762660 2:16292436-16292458 GGGAATCCATGGACAGCTTATGG - Intergenic
926879883 2:17533151-17533173 GGTTATTCATGTACAGGTAATGG - Intergenic
933729591 2:85446651-85446673 GGGCCTGCATGTCCAGTAAAAGG - Intergenic
934886347 2:98028840-98028862 GGGAATATATGTACATTTATAGG - Intergenic
936504438 2:113093890-113093912 TGGAAAGCATGTTTAGTTAATGG + Intergenic
936848181 2:116863277-116863299 GGGAATGCATTTACAGCTCATGG + Intergenic
943527702 2:189038643-189038665 GGGAATGCTTATACACTTATTGG - Intronic
944613337 2:201433818-201433840 TGGAATGCCTGTTCAGTCAAAGG - Intronic
1173723630 20:45281327-45281349 GTGAATGTATGTACATTTTATGG - Intergenic
1183141087 22:35940002-35940024 AGGAATGAAAGTACAGTGAATGG - Intronic
951343765 3:21521333-21521355 GTGAATGAATGAACAGCTAAAGG - Intronic
956369893 3:68548085-68548107 AGGAGTGTATGTACAATTAATGG - Intergenic
959499004 3:107084120-107084142 GGGAATGCATTGACAGTCACAGG + Intergenic
961923456 3:130451303-130451325 GGAAAAGCATGTATAGATAAGGG + Intronic
962370624 3:134818096-134818118 GGGAAGGCATGTCCAGGTACTGG + Intronic
965538641 3:169850725-169850747 GTGAATGCATGTAAAGTTCTTGG + Intronic
967852133 3:194090174-194090196 GGTAATGCAGGTAATGTTAAAGG + Intergenic
969826969 4:9765224-9765246 GGGGATGCATGTACAGCTCCAGG + Intergenic
971843615 4:31889687-31889709 AGGAAAACATGTACTGTTAAAGG + Intergenic
971877241 4:32323163-32323185 GGGAATGCTTGAAGAGTAAAGGG + Intergenic
972167798 4:36308679-36308701 GGGAATGCATGTTCCTTTATGGG + Intronic
972512785 4:39785297-39785319 GGGCAAGTATGTATAGTTAAGGG + Intergenic
973991707 4:56415090-56415112 GGGAATGCCTGTAAACATAATGG + Intronic
979796923 4:124857558-124857580 TGGAATGCTTGTACAAGTAAAGG + Intergenic
979928122 4:126593521-126593543 GGGAATGAATGTTCAGTAACAGG + Intergenic
983660860 4:170129747-170129769 TGGAATGCATGTTCAGGAAAAGG - Intergenic
988557514 5:32250462-32250484 GGGAATGCAAGAACAGCAAAGGG - Intronic
988873869 5:35421986-35422008 GGGAATGCTTGTACATTTGTGGG + Intergenic
992200072 5:74374506-74374528 GGGAATGTATGTATATTTACTGG - Intergenic
996866593 5:128130980-128131002 GTGAATTCATGTATAATTAAAGG + Intronic
997516020 5:134490501-134490523 GGGATTGCATTGACAGATAATGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
1008015749 6:46517620-46517642 GTGTATGCATGTAAAGTTCAGGG + Intergenic
1011051083 6:83150291-83150313 GGGAATGTATGTACAGGTGTTGG + Intronic
1011935458 6:92770934-92770956 GGCAATGAATGTAGAGTGAATGG + Intergenic
1017514728 6:155145835-155145857 GGGAATGGCAGTACAATTAAAGG - Intronic
1017883184 6:158576160-158576182 GGGAATGCTTGTACATTAGATGG + Intronic
1020366315 7:7384395-7384417 GGAAATGAAAGTACAGATAAAGG - Intronic
1029964621 7:104726231-104726253 GAAAATGAATGAACAGTTAAAGG - Intronic
1030442429 7:109604100-109604122 GTGAATGCATGTTCAGGTTAAGG - Intergenic
1031165361 7:118221451-118221473 GGGACTGCATATACAATTACAGG - Intronic
1031992988 7:128209926-128209948 GGGAATGCGTGTGCAGCTCAAGG + Intergenic
1032334584 7:131013190-131013212 TGGAGTGCCTGTAGAGTTAACGG - Intergenic
1033789318 7:144772210-144772232 GGGGATGCCTGGACAGTAAAAGG + Intronic
1035914463 8:3604020-3604042 AGGAATGCATTTACATTTACAGG - Intronic
1036031113 8:4974647-4974669 TGGAAGGCATGTACAAATAATGG + Intronic
1039169750 8:34729830-34729852 GGGAATCAATGTGCAGTTGAGGG + Intergenic
1040122453 8:43698465-43698487 GGGAATGCAGGTTCAGGGAAGGG - Intergenic
1046411835 8:113855123-113855145 GGGAGTTGATGTACAGTAAAAGG - Intergenic
1046745604 8:117872844-117872866 AGAAATGCATGTCCAGTTTAGGG + Intronic
1048357416 8:133664862-133664884 GGGAAGGCATGTGCGTTTAAGGG - Intergenic
1050589246 9:7145459-7145481 GGGTAAGAATGAACAGTTAAGGG - Intergenic
1050849843 9:10270344-10270366 GGCAATGCATCTCTAGTTAAGGG + Intronic
1054824633 9:69560583-69560605 GGGAATGCATGTAAAGTACTTGG + Intronic
1055673700 9:78633200-78633222 GTGAATGAATGGAGAGTTAAAGG + Intergenic
1057169633 9:92953694-92953716 AGGAAGGCAGGTAAAGTTAAGGG + Intronic
1061991627 9:134162481-134162503 GGGGGTGCAGGTACTGTTAAAGG + Intergenic
1187644217 X:21328815-21328837 GTGAATGCATGCACAGTCACTGG + Intergenic
1190569315 X:51765863-51765885 GGGAATGCATGTTCTATTTAAGG - Intergenic
1191744672 X:64473459-64473481 GGGAAGGCAGGGATAGTTAATGG - Intergenic
1193407313 X:81118168-81118190 GCAAAGGCATGTACATTTAATGG + Intronic
1195806572 X:108778164-108778186 GAAAATGTATGTACAGTTGAAGG + Intergenic
1199096985 X:143755125-143755147 GGCAATGCATGAACAGAAAATGG - Intergenic
1200708596 Y:6464038-6464060 GGGACTGCTTGTGCAATTAAGGG + Intergenic
1200930687 Y:8694309-8694331 TGGAATGCTTGTGCAATTAAGGG + Intergenic
1200931680 Y:8702556-8702578 TGGACTGCTTGTACAATTAAGGG + Intergenic
1200939934 Y:8770667-8770689 TGGACTGCTTGTACAATTAAGGG + Intergenic
1200964956 Y:9027360-9027382 TGGACTGCTTGTGCAGTTAAGGG + Intergenic
1201025516 Y:9700670-9700692 GGGACTGCTTGTGCAATTAAGGG - Intergenic
1201867466 Y:18670463-18670485 GGGAATGCAGGTTCAGGAAAGGG + Intergenic
1202148152 Y:21821426-21821448 TGGACTGCTTGTGCAGTTAAGGG - Intergenic