ID: 1094360591

View in Genome Browser
Species Human (GRCh38)
Location 12:29626613-29626635
Sequence CTTTGGGTGTGCAGTGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094360591 Original CRISPR CTTTGGGTGTGCAGTGAAGT AGG (reversed) Intronic
901254131 1:7806379-7806401 CTGTGTATGTGAAGTGAAGTAGG - Intronic
902327153 1:15708664-15708686 CTTTGGGAGGCCAGTGAAGGAGG - Intronic
902408838 1:16201304-16201326 CTTTGGGTGTGAAGTGAGGCTGG - Intronic
903279914 1:22244577-22244599 CTCAGGGTGTGCAGAGAAGCAGG - Intergenic
904163446 1:28537683-28537705 CTCTGGGAGTTCAGGGAAGTTGG - Intronic
904790804 1:33019193-33019215 CTTGGGCTGTTCAGTGTAGTAGG - Intronic
904969816 1:34410681-34410703 CTTTGGCTGTGCCTTGATGTTGG - Intergenic
905631391 1:39520998-39521020 CTCTGGGTCTCCTGTGAAGTAGG + Intronic
905666363 1:39765173-39765195 CTCTGGGTCTCCTGTGAAGTAGG - Intronic
906130387 1:43452145-43452167 CTGTGGGTGTGCGGAGAAGGGGG - Exonic
907680077 1:56554874-56554896 CTATGAGTGTGAAGTGAACTTGG - Intronic
910684830 1:89905628-89905650 CTTTGGGTCTGCAGCCAAGTAGG + Intronic
911329696 1:96512641-96512663 CTTTAGGTATCCAGAGAAGTAGG + Intergenic
917328854 1:173861649-173861671 CTTTGGGAGGGCAGGGCAGTTGG + Intergenic
918863960 1:189870390-189870412 TTTTTGGTGCTCAGTGAAGTGGG + Intergenic
920663199 1:207936992-207937014 CTTTGGGGGTGTGGTGGAGTAGG - Intergenic
923622334 1:235588836-235588858 ATGTGGGTGTGGAGTGGAGTAGG - Intronic
924240526 1:242035623-242035645 TTTTGGGGGTGGGGTGAAGTCGG + Intergenic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1067194250 10:44101653-44101675 CTTTGCTTGTGCAATGAAGCTGG - Intergenic
1067195898 10:44117567-44117589 CATTGGGTGTGCAATGACCTTGG - Intergenic
1067257619 10:44659695-44659717 CTTTGTGAGTGCAGTGTATTGGG - Intergenic
1068221028 10:54045677-54045699 TTTTGTGTGTGGAGTGAGGTGGG - Intronic
1068590590 10:58849013-58849035 CTTTGGGAGTACAGAGAAGGAGG - Intergenic
1069070415 10:63986110-63986132 ATTTGGCTGAGGAGTGAAGTAGG - Intergenic
1071521580 10:86334693-86334715 CATTGTGTGTGCCTTGAAGTAGG - Intronic
1074978082 10:118596737-118596759 CTGTGGGTGTTCAGTCAAGGAGG - Intergenic
1076062247 10:127422115-127422137 TGTTGGGGGTGCAGAGAAGTTGG - Intronic
1076273607 10:129177745-129177767 CTTTGCTTGAGCAGTGAAATGGG + Intergenic
1076648894 10:131973600-131973622 CTTTGGGGATGCAGTGACCTGGG - Intronic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1079387423 11:19993054-19993076 CTTTGGGTGACCAGGGGAGTTGG - Intronic
1081687086 11:45050407-45050429 CTTGGGATGTGCCTTGAAGTAGG - Intergenic
1082115553 11:48324552-48324574 CTTGGGGTTTGCAATGAGGTTGG - Intergenic
1082124709 11:48418498-48418520 GTTTGTGTCTGCAGGGAAGTAGG + Intergenic
1082187845 11:49206709-49206731 GTTTGCGTTTCCAGTGAAGTAGG + Intronic
1082258115 11:50054757-50054779 CTTGGAGTTTGCAATGAAGTTGG + Intergenic
1084276130 11:68051846-68051868 CTTGGGGCGGGCAGTGAGGTGGG + Intergenic
1086678470 11:89638677-89638699 GTTTGTGTTTCCAGTGAAGTAGG - Intergenic
1089916911 11:122165758-122165780 GTATGTGTGTGCAGGGAAGTGGG - Intergenic
1090712365 11:129399193-129399215 CTCTGGGAGTGCAGTTAATTAGG + Intronic
1090998694 11:131890001-131890023 CTTTGGGTGGGCTGAGAAGGAGG - Intronic
1091029583 11:132173343-132173365 CCATGAGTGTGCAGCGAAGTGGG + Intronic
1091423212 12:361676-361698 CTTTGGGTATACAGTGATTTGGG - Intronic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1093617166 12:21240199-21240221 ATTTGTGTGTTCACTGAAGTAGG + Intergenic
1094360591 12:29626613-29626635 CTTTGGGTGTGCAGTGAAGTAGG - Intronic
1095561015 12:43565012-43565034 TTCTGGGTATGCTGTGAAGTAGG - Intergenic
1098328125 12:69323722-69323744 ATTTGGGGGTGTAGTGAAGGGGG - Intergenic
1101597988 12:106184019-106184041 CTTAGGGTGAGCAGTTAATTTGG + Intergenic
1103510355 12:121469283-121469305 CTTTGGGAATGGAGTGATGTGGG - Intronic
1107347325 13:39475760-39475782 CTTTGGGTGTGCTGTGATCACGG - Intronic
1107517354 13:41143758-41143780 CTTTGGGTTTATAGTCAAGTTGG - Intergenic
1110441553 13:75532115-75532137 CTTTTGGGGTGGAGAGAAGTGGG + Intronic
1113484432 13:110643907-110643929 CCCTGGCTGTGCAGTGAAGGTGG - Intronic
1114259810 14:21028318-21028340 GTTTGGGGCTGCAGTGAACTAGG - Intronic
1114541354 14:23462299-23462321 TTTTGTGTGTGGTGTGAAGTAGG - Intergenic
1115760842 14:36578775-36578797 CTTGGAGTGTGCAGTGGAGAAGG - Intergenic
1117568550 14:57021973-57021995 CTTTGGGAGTACAGTGCAGAAGG - Intergenic
1118188559 14:63559625-63559647 CTTTGGGCATGCACTGAGGTAGG - Intergenic
1121556317 14:94840418-94840440 CTTGGGGTGTGCAGGGAGGTGGG + Intergenic
1122773903 14:104108811-104108833 GTTTGGGTGTGCAGTGGGGCCGG + Intronic
1125501916 15:40245189-40245211 CTCTGGGTGTCCAGGGAAGCAGG + Intronic
1125519084 15:40338355-40338377 CTTTGGGTGGGCCTTGAAGTGGG - Intronic
1130513183 15:84605754-84605776 CTTCAGGTGTGCAGTGATGGGGG + Intronic
1132849782 16:2019825-2019847 GTTTGGGCGCGCAGTGGAGTTGG - Exonic
1132868377 16:2104755-2104777 CTGTGGGGGTCCAGTCAAGTGGG - Intronic
1133088302 16:3382987-3383009 TTTTCGGTGGGCACTGAAGTGGG + Exonic
1133299745 16:4775081-4775103 CTTGGGATGTGCTGTGACGTGGG + Intergenic
1133795853 16:9045568-9045590 CTTTGGGAGTCCAGTGCAGGAGG + Intergenic
1134710946 16:16326730-16326752 CTGTGGGGGTCCAGTCAAGTGGG + Intergenic
1134948637 16:18341879-18341901 CTGTGGGGGTCCAGTCAAGTGGG - Intergenic
1135326856 16:21531748-21531770 TTTTGTGTGTGCTGTGAGGTAGG + Intergenic
1136273511 16:29163307-29163329 CTTTGTGTGTGCTGTGAGGTGGG + Intergenic
1136337113 16:29617162-29617184 TTTTGTGTGTGCTGTGAGGTAGG + Intergenic
1139919318 16:70449354-70449376 CCTGGGCTCTGCAGTGAAGTGGG - Intergenic
1140448945 16:75054491-75054513 CATAGGGTCTGCAGGGAAGTGGG + Intronic
1140995037 16:80250866-80250888 CTTTGGGAGTGCAGCCCAGTAGG - Intergenic
1141250905 16:82358285-82358307 CTTTGGCTGAGAAGAGAAGTGGG + Intergenic
1141835087 16:86533019-86533041 TTTTGGCTGTGCATTGAAGGGGG - Intronic
1142039907 16:87886492-87886514 TTTTGTGTGTGCTGTGAGGTAGG + Exonic
1142077050 16:88125054-88125076 CTTTGTGTGTGCTGTGAGGTGGG + Intergenic
1142632487 17:1234203-1234225 CCTGGGATGTGCAGTGAAGGTGG - Intergenic
1145968715 17:28941175-28941197 CCTTGGGTATGCAGTTAAGTAGG - Intronic
1147217782 17:38911098-38911120 CCTGGGGTGTGCAGTGCTGTGGG + Intronic
1147370527 17:39989521-39989543 CTTAGGGAATGCAGTGCAGTGGG - Intronic
1148074265 17:44926549-44926571 CTATGGGTGTGCATTGAAGTGGG + Intronic
1151596661 17:75082158-75082180 CTTTGGGGGTGGAATGGAGTGGG - Intergenic
1152304112 17:79511270-79511292 CTGTGTGTGTGCAGTGTCGTGGG + Intronic
1155103771 18:22640541-22640563 GCTTGGGTGTGCAGTGAAAATGG - Intergenic
1155488955 18:26379372-26379394 ATTTGTGTCTGCTGTGAAGTGGG + Intronic
1155620788 18:27776927-27776949 GTTTGGGAGTGCAGTGGAGAAGG - Intergenic
1156795594 18:41042079-41042101 CTTTTGGTGTGCAATAAAGAAGG - Intergenic
1160341948 18:78097047-78097069 CTTTGGGGGTTCAGTGAGGCAGG + Intergenic
1160387052 18:78503117-78503139 CTTTGGATGAGCAGTGAATGTGG - Intergenic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164014690 19:21242954-21242976 CTCTGGGTTTGTAGTGGAGTTGG - Intronic
1164031276 19:21408001-21408023 CTCTGGGTTTGTAGTGGAGTGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1165381411 19:35483798-35483820 CTTTGGGAGTCCAGTGCAGGCGG + Intergenic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1167276300 19:48542078-48542100 CTTTAGGTGGGCAGTCAAGGTGG - Intergenic
1167716106 19:51143705-51143727 CCTTGTGTGAGCAGAGAAGTGGG - Intronic
926068787 2:9867210-9867232 CTTTGAGTGTACAGAGAGGTGGG + Intronic
926359674 2:12074427-12074449 CTTTTGGTGGCCAGAGAAGTAGG - Intergenic
926764394 2:16311523-16311545 CTTTGAGTGTTCAGTGACTTTGG - Intergenic
926944539 2:18172470-18172492 CTTTGAATGTCCAGTGAAGCTGG + Intronic
926971386 2:18470793-18470815 CTTTGGGTGGGGGTTGAAGTTGG + Intergenic
928365190 2:30695158-30695180 CATTAAGTGTTCAGTGAAGTTGG - Intergenic
928659543 2:33487446-33487468 ATTTGGGTGTGCAGGAAAGGAGG + Intronic
931218638 2:60269116-60269138 TTTTGGGTGAGTAGTGTAGTTGG - Intergenic
932307682 2:70715554-70715576 CTCTTGGTGTGCAGTCAAGCTGG + Intronic
932330432 2:70895595-70895617 CTTGGGGTGTCCAGAGAGGTGGG - Intergenic
933628166 2:84626277-84626299 CTTTGTGTGTCTAATGAAGTTGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
937430001 2:121830305-121830327 CTTTGGTGGGGCAGTGAAGGAGG - Intergenic
939153145 2:138496082-138496104 CTTTGTGTGTCCAGAGAAATAGG + Intergenic
941409921 2:165142131-165142153 CCCTGGGTGTGAAGAGAAGTAGG - Intronic
946731586 2:222714964-222714986 ATGTGGGTTTGCAGTGATGTGGG + Intergenic
1169051483 20:2582274-2582296 CTTTAGATGTGCAATGAATTTGG - Intronic
1177713283 21:24807543-24807565 CTGTGGGTCAGCAGAGAAGTAGG + Intergenic
1178605715 21:34035053-34035075 TTTTTGGTGGGCAGTGAGGTGGG + Intergenic
1180864825 22:19111673-19111695 CTTTGGGTATGCAGTGGTATGGG - Intronic
1181588005 22:23864647-23864669 GTCTGAGTGTGCACTGAAGTGGG - Intronic
1183172222 22:36196970-36196992 CTTTAGGTGGGCAGGGGAGTGGG + Intronic
1183187681 22:36301348-36301370 CATTGGGTGTTAAGTGATGTAGG - Intronic
1183720772 22:39560189-39560211 CTTGGGGTGTGGGGTGAAGGTGG - Intergenic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
952752390 3:36835409-36835431 CTCTGTGTGTGCTGTGAGGTTGG - Intronic
952828381 3:37542922-37542944 CTCTGGGTCTGCAGTGATGCTGG + Intronic
954308814 3:49748483-49748505 CTTTGGGTGTGAAGTAAACCGGG - Intronic
956051301 3:65251345-65251367 CATTGGGAGGGCAGTGTAGTTGG - Intergenic
956408409 3:68952650-68952672 CCTTGGGTATCCAGTGCAGTGGG - Intergenic
961559888 3:127721439-127721461 CTTTGGGCTTGAAATGAAGTGGG - Intronic
964986136 3:162741903-162741925 CTGTAGGTGTGCACCGAAGTTGG + Intergenic
966028561 3:175316850-175316872 TTTTGGATTTCCAGTGAAGTTGG - Intronic
966418955 3:179718675-179718697 CTTCAGGTGCACAGTGAAGTTGG - Intronic
967083064 3:186068583-186068605 TGTTGGGTGTGCAGTGTAGAAGG + Intronic
969539252 4:7776155-7776177 CTTGGGGTGTGCAGTCAGGAAGG - Intronic
969719456 4:8885274-8885296 CTTTGGGTCTTCTGTGGAGTTGG - Intergenic
969819057 4:9707145-9707167 CTTTGAGTGAGCAGAGCAGTTGG - Intergenic
974714455 4:65649319-65649341 CTTTGGATGTCCAGGGAAATAGG - Intronic
977524773 4:98130424-98130446 CTTTGGGAGGCCAGGGAAGTGGG - Intronic
977751365 4:100613641-100613663 GCTGGGGTCTGCAGTGAAGTTGG + Intronic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
981660350 4:147158727-147158749 CTTTGGGTGTGGATTCAACTGGG + Intergenic
982734835 4:158995159-158995181 CTTTGGGTGTCCAGAGTAGGAGG - Intronic
983087373 4:163463809-163463831 CATTGTGTGTGGTGTGAAGTTGG - Intergenic
983505459 4:168548115-168548137 CTTTGGGTCTGACGTGTAGTTGG - Intronic
987379809 5:17275092-17275114 TTTGGGGTGTGCAGTGCAGCAGG + Intronic
987969360 5:24922321-24922343 CTTTAGGTGTGAAGCGAATTAGG + Intergenic
988612169 5:32737066-32737088 CTTTGCCTGTGCTGTGATGTAGG + Intronic
989099487 5:37810914-37810936 CCGTGAGTGTGGAGTGAAGTAGG - Intergenic
989125536 5:38049097-38049119 CCTTGGGTATGCAGGGGAGTGGG + Intergenic
991077278 5:62554956-62554978 CTTTGGGAGTCCAGTGCAGGTGG - Intronic
991931075 5:71752797-71752819 CCTTGGGTGTGCAGTAATGATGG - Intergenic
992003188 5:72454805-72454827 CTCTGGGGGCTCAGTGAAGTGGG + Intronic
996214509 5:120850385-120850407 TTTTGAGTGTGCAGTGAGCTAGG + Intergenic
1000771585 5:165361638-165361660 CTTTGGGAGTGGGGTGAAGGTGG - Intergenic
1004198453 6:13526623-13526645 TTTGCGGTTTGCAGTGAAGTAGG - Intergenic
1004687693 6:17962979-17963001 CTTTGAGTTTACAGTGTAGTGGG - Intronic
1006203920 6:32322602-32322624 ACTTGGGTGGGCAGTGAAGGAGG + Intronic
1011044081 6:83062899-83062921 TTTTGTGTTTGCAGTGAAGTAGG - Intronic
1012947339 6:105481524-105481546 CTTTGGGTTAGCAGTGGAGGTGG + Intergenic
1013434797 6:110092468-110092490 CTTTGTGTGTGGTGTGAGGTGGG - Intergenic
1014622535 6:123686554-123686576 CTTTAGGTATGATGTGAAGTTGG - Intergenic
1015868356 6:137750838-137750860 CTTTGAGGGTGCAGTGAGCTGGG + Intergenic
1017070591 6:150572563-150572585 TTTTAGCTGTGCAGTGAATTGGG - Intergenic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1017890590 6:158635456-158635478 CTTTGTGTGTGGAGTTAATTTGG + Intergenic
1018004093 6:159604203-159604225 CTTTAAGTGTGCAGAGAAGAAGG - Intergenic
1020002347 7:4763012-4763034 CTTGGGGTCTGAAGTGAAATCGG - Exonic
1020625256 7:10570088-10570110 CTTTGGGTGAGTAGTTAAGGAGG - Intergenic
1020689185 7:11333477-11333499 CTTTTGCTGTGAAGTGAATTTGG - Intergenic
1023122528 7:36924259-36924281 CTTTGGGGGTGCACTGAAACTGG + Intronic
1023335463 7:39164627-39164649 CTTAGGGTGTGCACTGAAGCAGG + Intronic
1024308036 7:47944551-47944573 CTTTGGGTGTGCTGAGAACCAGG - Intronic
1025159861 7:56647108-56647130 TTTTGGGTATGCAGTGGAGAGGG - Intergenic
1025726858 7:64072228-64072250 TTTTGGGTATGCAGTGGAGAGGG + Intronic
1026504855 7:70973792-70973814 CTTTGGGAGGCCAGGGAAGTAGG + Intergenic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1030114275 7:106051181-106051203 CTTAGGCTGGGCAGTGTAGTTGG + Intergenic
1030231493 7:107212674-107212696 CTGTGGGTGGGCAATGAAGCCGG - Intronic
1032310620 7:130782869-130782891 CTTTGTGTTTGGTGTGAAGTAGG + Intergenic
1040426623 8:47294250-47294272 CATTCGGTGTGCAGTGAGGGTGG - Intronic
1041256660 8:55984608-55984630 CTTTGAGTGTGTATTCAAGTTGG - Intronic
1042836926 8:73087439-73087461 CCCTGGGTGAGCAGTGAAGGAGG - Intronic
1044904188 8:96982119-96982141 CTTTGGTGGAGCAGTGATGTGGG + Intronic
1048975695 8:139671936-139671958 CATGGGGTCTGCAGTGCAGTGGG + Intronic
1049312718 8:141941995-141942017 CTTGGGTTGTGCACTGAAGTTGG + Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1052354470 9:27490068-27490090 CTTTGTGTGTGCAATGCAGAGGG - Intronic
1056884170 9:90424111-90424133 GTGTGAGTGTGCAGTGAAGGGGG - Intergenic
1059341478 9:113599884-113599906 CTTTGGCTGTGCAGAGCAGCTGG + Intergenic
1061392283 9:130324057-130324079 GTTTAGGTGTGCAGTGGTGTTGG + Intronic
1061413275 9:130432323-130432345 CTTTGGGGGACCAGTGAGGTGGG - Intronic
1061859687 9:133461504-133461526 ATTAGGGTGGGCAGTGCAGTGGG + Intronic
1062482544 9:136759263-136759285 CTATGGGTCTGCAGTGCTGTGGG - Intergenic
1185668362 X:1786521-1786543 CTTTGTGGGTGAAGTGAAGGGGG - Intergenic
1187776415 X:22763871-22763893 CTTTAAGTGGGCAGTGAACTTGG - Intergenic
1188478260 X:30610311-30610333 CTTTGGGTGTGCTGTGTAAAAGG + Intergenic
1188919380 X:35953428-35953450 CTCTGGCTGTGCAGTAAATTTGG + Intronic
1189055717 X:37697696-37697718 CTTTGGGTGTACAATTCAGTAGG + Intronic
1191900082 X:66031849-66031871 ATTTGGGTTTACAATGAAGTGGG + Intronic
1192158629 X:68766325-68766347 ATTTGCATCTGCAGTGAAGTAGG + Intergenic
1192787650 X:74350798-74350820 CATTTGCTTTGCAGTGAAGTGGG - Intergenic
1194823176 X:98530237-98530259 CTTTGGGGGTACAATGAAGAAGG - Intergenic
1196445106 X:115841842-115841864 CTTTGCGACTGCAGTGAACTGGG + Intergenic
1196938505 X:120753019-120753041 GTTTGGATGTGCTGTGAAGAGGG + Intergenic
1198685109 X:139220575-139220597 ATTTGGGTGTGCAGAGAAGTGGG + Intronic
1198948671 X:142043743-142043765 TTGTAGGTGTGCAGTGAAGCAGG + Intergenic
1199133672 X:144225739-144225761 ATTTGTATGTGGAGTGAAGTGGG + Intergenic
1199376974 X:147124218-147124240 CTATGGTAGTGCACTGAAGTTGG - Intergenic
1199925081 X:152453913-152453935 TTTTTGGTTTGCAGTCAAGTGGG - Intergenic
1201947830 Y:19531106-19531128 CTAAGGCTGTGCAGGGAAGTAGG - Intergenic