ID: 1094361213

View in Genome Browser
Species Human (GRCh38)
Location 12:29633262-29633284
Sequence CAGTCATAGCACAGGGTCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094361202_1094361213 23 Left 1094361202 12:29633216-29633238 CCGCATGTCCCATATGGTCTCTA 0: 1
1: 0
2: 1
3: 19
4: 131
Right 1094361213 12:29633262-29633284 CAGTCATAGCACAGGGTCACGGG 0: 1
1: 0
2: 1
3: 13
4: 210
1094361204_1094361213 15 Left 1094361204 12:29633224-29633246 CCCATATGGTCTCTACCAGAGGA 0: 1
1: 0
2: 1
3: 9
4: 60
Right 1094361213 12:29633262-29633284 CAGTCATAGCACAGGGTCACGGG 0: 1
1: 0
2: 1
3: 13
4: 210
1094361205_1094361213 14 Left 1094361205 12:29633225-29633247 CCATATGGTCTCTACCAGAGGAA 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1094361213 12:29633262-29633284 CAGTCATAGCACAGGGTCACGGG 0: 1
1: 0
2: 1
3: 13
4: 210
1094361206_1094361213 0 Left 1094361206 12:29633239-29633261 CCAGAGGAATACTGCCGACCTGC 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1094361213 12:29633262-29633284 CAGTCATAGCACAGGGTCACGGG 0: 1
1: 0
2: 1
3: 13
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094361213 Original CRISPR CAGTCATAGCACAGGGTCAC GGG Exonic
900723236 1:4194306-4194328 AGTTCATAGCCCAGGGTCACAGG - Intergenic
901221040 1:7583934-7583956 CCGTCAGAGCTCAGGGTCCCAGG - Intronic
903136159 1:21310606-21310628 CAGTGAAAGCACAGGGCCAGAGG - Intronic
903164303 1:21509838-21509860 CAGACAGAGCGCAGGGTCCCAGG - Intronic
903389281 1:22953027-22953049 CAGGCAGAGCCCGGGGTCACTGG + Exonic
903625014 1:24724420-24724442 CAGTGATGGCACAGGGACCCAGG + Intergenic
905514500 1:38552212-38552234 CAATCATATCAGATGGTCACTGG + Intergenic
907872144 1:58453238-58453260 CACTCAAAGCAAAGGGGCACAGG + Intronic
909036074 1:70595310-70595332 CAGTGAGAGCACATGGACACAGG - Intergenic
914885656 1:151582270-151582292 CAGTCAAAGCTTAGGTTCACTGG - Exonic
915789511 1:158652873-158652895 CAGTCATACTATTGGGTCACTGG - Intronic
916013937 1:160731610-160731632 CAGTGAGAACACATGGTCACAGG - Intergenic
916919602 1:169450098-169450120 AAGTCACAGCCCAGGGACACAGG - Intronic
917393273 1:174562801-174562823 CAGTGAGAACACAGGGACACAGG + Intronic
917872491 1:179254540-179254562 CAGTCATAGCACAGACTGATTGG + Intergenic
920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG + Intergenic
920993899 1:210968061-210968083 CAGTGAGATCACATGGTCACAGG - Intronic
921169174 1:212530837-212530859 AATACATAGCACAAGGTCACTGG + Intergenic
921558571 1:216628943-216628965 CAGTCATTGCACAAGCTCAGAGG - Intronic
922638959 1:227207559-227207581 CAGTGAGATCACAGGGACACAGG - Intronic
924401216 1:243684351-243684373 CAGTGAGAACACAGGGACACAGG - Intronic
1063809875 10:9692621-9692643 CAGTACTATCACAGGCTCACGGG + Intergenic
1064031650 10:11886789-11886811 CAGAGCTGGCACAGGGTCACAGG + Intergenic
1071328591 10:84540275-84540297 GAGACATAGCCCAGGGTAACAGG - Intergenic
1072848654 10:98861734-98861756 CAGCCATACCACAGGGTCACTGG + Intronic
1075208884 10:120473814-120473836 CAGTCATAGCAGAAGGGCAAAGG - Intronic
1076605118 10:131684226-131684248 CAGCCATCCCACAGGGCCACGGG - Intergenic
1076899447 10:133330202-133330224 CCGCCATAGCACCGGGCCACAGG - Intronic
1078607074 11:12786120-12786142 CAGTCACAGCACAGGGTGGGAGG + Intronic
1078721378 11:13887018-13887040 CAGTCATAGCAGAAGGGCAAAGG - Intergenic
1080543815 11:33296214-33296236 CGGCCATACCACAGGGACACTGG - Intronic
1081578272 11:44333323-44333345 CAGTGAGAGCACATGGACACGGG - Intergenic
1084166323 11:67376333-67376355 CAGGCATGGCAGAGGGGCACTGG - Intronic
1084687737 11:70706942-70706964 CAGTCAGAGCGCAGGATCAGAGG - Intronic
1086507997 11:87526119-87526141 CAGTCATTGCAAACGGTGACTGG - Intergenic
1088644356 11:111904840-111904862 CAGTCATGGCAGAGGGTGAAAGG - Intergenic
1088730591 11:112678748-112678770 CAGTGATAACACATGGACACAGG - Intergenic
1088839267 11:113609890-113609912 CAGTGATAACACATGGACACAGG + Intergenic
1090013613 11:123065741-123065763 TAGTCATGTCACCGGGTCACAGG - Intergenic
1091146061 11:133281428-133281450 CAGTCATGGCAGAAGGTGACAGG - Intronic
1091517414 12:1198722-1198744 CAGTCATAGCAGAAGGTGAAGGG + Intronic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1094361213 12:29633262-29633284 CAGTCATAGCACAGGGTCACGGG + Exonic
1095780763 12:46056610-46056632 CAGTGAGAGCACATGGACACAGG + Intergenic
1096280041 12:50244940-50244962 AGGTCAAAACACAGGGTCACTGG + Intronic
1098002630 12:65961293-65961315 AAGTGAAAGGACAGGGTCACAGG + Intronic
1099044010 12:77693666-77693688 CAGGCATAGCAAATGGTAACAGG - Intergenic
1103247526 12:119470799-119470821 CAATAATAGCACAGGGTAATGGG - Intronic
1103942122 12:124506839-124506861 CCGTCACAGCCCAGGGGCACGGG - Intronic
1104183220 12:126402639-126402661 CAGGCATATCACAAGGTCAGGGG + Intergenic
1106923051 13:34585475-34585497 CTGACATAGGACAGGGTGACAGG - Intergenic
1107707107 13:43119196-43119218 CAGGCAAAGCAGAGGATCACTGG - Intergenic
1108832688 13:54499161-54499183 CAGTCATGGCACAAGGTGAAAGG - Intergenic
1111853813 13:93610023-93610045 CAGCCATATGACAGGGTCACAGG - Intronic
1113049452 13:106193314-106193336 CAGTAAGAACACAGGGACACAGG + Intergenic
1113086717 13:106576509-106576531 AGGTCACAGCCCAGGGTCACAGG - Intergenic
1113905171 13:113815993-113816015 CAGTCACTGCTCAGGGACACGGG + Exonic
1113905182 13:113816069-113816091 CAGTCACTGCTCAGGGACACGGG + Exonic
1116433285 14:44870559-44870581 CAGTGAAAGCACATGGACACAGG - Intergenic
1116915217 14:50518437-50518459 CAGTGAGAACACAGGGACACAGG - Intronic
1117405722 14:55401457-55401479 CAGGCATGGAACAGGTTCACTGG - Intronic
1117441152 14:55760577-55760599 CATTCATAGCACAAGTTCATTGG - Intergenic
1117855186 14:60023840-60023862 CAGTGAGAGCACATGGACACAGG - Intronic
1123088089 14:105727372-105727394 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1123094044 14:105756745-105756767 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1123576085 15:21670677-21670699 CAGTGAGAACACAGGGACACAGG - Intergenic
1123612706 15:22113151-22113173 CAGTGAGAACACAGGGACACAGG - Intergenic
1126350323 15:47739128-47739150 CACTCATAGCCCAGATTCACAGG + Intronic
1127538894 15:59917879-59917901 CAGTCACAGCATGGGGTCAGAGG + Intergenic
1130126995 15:81102364-81102386 CAGTCATAGAAGTGGGTCACAGG + Intronic
1130642867 15:85695542-85695564 CAGTCATATCAAAAAGTCACAGG - Intronic
1131240595 15:90739166-90739188 CAGGCAGATCACAAGGTCACAGG + Intronic
1202984953 15_KI270727v1_random:404922-404944 CAGTGAGAACACAGGGACACAGG - Intergenic
1132540769 16:508220-508242 CAGTCACAGCACCGGGTCAGAGG - Intronic
1133293387 16:4737415-4737437 AAGTGATGGCTCAGGGTCACAGG + Intronic
1135601082 16:23784010-23784032 CAGTGAGATCACAGGGACACAGG - Intergenic
1136900684 16:34034396-34034418 CAGTCATGGCACAAGGTGAAAGG + Intergenic
1137088422 16:36158320-36158342 CAATCATGGCACAGGGTGAAAGG + Intergenic
1137988157 16:53128092-53128114 CCGTCATAGCACAGGCTTTCTGG + Intronic
1141134996 16:81459339-81459361 GGGTCACAGCACAGGGCCACGGG - Intronic
1141855688 16:86679872-86679894 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1141886050 16:86893059-86893081 CACTCATAGCCCTGGGTCAGGGG + Intergenic
1142598661 17:1041990-1042012 CAGTCATGCCCTAGGGTCACGGG + Intronic
1142918005 17:3159317-3159339 CAGTGAGAACACAGGGACACAGG + Intergenic
1142990887 17:3730084-3730106 CAGTGAGAGCACATGGACACAGG - Intronic
1143269700 17:5666401-5666423 CAGTCATGGCACTGGGTAACTGG + Intergenic
1144017637 17:11211640-11211662 CAGTCATCAAACAGGGTGACAGG + Intergenic
1147878790 17:43640873-43640895 CAGTCACAGGACACTGTCACTGG + Exonic
1148196118 17:45714604-45714626 CAGCTATTCCACAGGGTCACTGG - Intergenic
1148906754 17:50917264-50917286 AAATCACAGCACAGGGGCACAGG - Intergenic
1151160052 17:72157721-72157743 CTGTCATTGCAAAGTGTCACAGG - Intergenic
1152114319 17:78375760-78375782 CAGCCATGGTACAGGCTCACTGG - Intergenic
1153577714 18:6539385-6539407 CAGTGATAGCACAGGGCCTTTGG + Intronic
1153758919 18:8311469-8311491 CATTCACAGCACAGAGGCACAGG - Intronic
1157164963 18:45350377-45350399 CACTCATAGCTCAAGGTCACAGG + Intronic
1162246195 19:9403542-9403564 CAGTGATAACACATGGACACAGG + Intergenic
1163724329 19:18913849-18913871 CTGTCAAGGCACAGGGTCAAAGG + Intronic
1164478993 19:28597235-28597257 CAGTCATTGCTCCTGGTCACAGG + Intergenic
1164984139 19:32635972-32635994 CAGCCATGGCAGTGGGTCACAGG - Intronic
1165607881 19:37122410-37122432 CAGTGAGAACACAGGGACACAGG + Intronic
1165664610 19:37617307-37617329 TAGTCATAGCACATGGTGAAGGG - Intronic
1167654182 19:50752757-50752779 CAGACACAGCACAAGGTGACGGG + Intergenic
925656442 2:6155120-6155142 CAGTCATACCTGAGGGTCAATGG - Intergenic
926480135 2:13382490-13382512 CAGTTATAGCAAAAGGTCAAGGG + Intergenic
926793939 2:16603418-16603440 CAGTGACAGATCAGGGTCACTGG + Intronic
926797156 2:16628471-16628493 CTGTCAGAGCACATGGGCACAGG + Intronic
927670486 2:25064993-25065015 CACCCCTAGCCCAGGGTCACTGG + Intronic
928259364 2:29752962-29752984 CAGACCCAGCCCAGGGTCACAGG + Intronic
930691379 2:54369098-54369120 CAGCCATCACACTGGGTCACAGG + Intronic
932792205 2:74663589-74663611 CAGTCATGGCAGAGGGTGAAGGG + Intronic
932872746 2:75419731-75419753 CAGTCTTGGCAGAGGGTCAGTGG + Intergenic
933557816 2:83852053-83852075 CAGTGAGAACACAGGGACACAGG + Intergenic
937813183 2:126221348-126221370 CAGTCAGAACACATGGACACAGG - Intergenic
938143118 2:128812511-128812533 CAGGCATTGCAAAGGGTCACGGG - Intergenic
939162812 2:138609434-138609456 CAGACATAGACCAGGGTCAGGGG + Intergenic
939772823 2:146344360-146344382 CAATGTTAGCACAGGGTCACTGG + Intergenic
942009347 2:171743482-171743504 CAGTCATAGCAGATGCTCACTGG - Intronic
942356297 2:175115275-175115297 CAGCCATAACACAGTCTCACTGG - Intronic
942693515 2:178612783-178612805 CCGGCAAAGCACAGGGTCACTGG + Exonic
943357501 2:186875520-186875542 CAGTCAAAGCACAAGGGGACTGG - Intergenic
945780213 2:214161622-214161644 CAGTGAGAGCACATGGACACAGG + Intronic
946923002 2:224598477-224598499 CAGTCATGACACAGGCACACAGG - Intergenic
947709900 2:232307081-232307103 CAGGCACGGCACAGGGCCACGGG - Intronic
948398732 2:237667222-237667244 CAGTGAAAGCACATGGTCACAGG - Intronic
1169457057 20:5761203-5761225 CAGTGAGAACACAGGGACACAGG + Intronic
1172195807 20:33090682-33090704 CAGGCAAAGGAGAGGGTCACAGG - Intronic
1180032199 21:45219943-45219965 CAGTCAAAGCACAGGCTGACTGG - Intronic
1181422639 22:22812273-22812295 TAATCATAGCACAGTGACACTGG + Intronic
1184019097 22:41808620-41808642 CACTTAGAGCACAGGGTCAGTGG - Intronic
1184607245 22:45581229-45581251 CAGCCATAGCCCAGGGGCCCGGG - Intronic
950479679 3:13236702-13236724 CAGCCCTAGCACAGGGGCCCGGG - Intergenic
950920183 3:16686071-16686093 CAATCAAAGCACATGGACACAGG - Intergenic
951512288 3:23516128-23516150 CAGTAATAGAACAGTGTAACTGG - Intronic
954117571 3:48475660-48475682 GAGTCACAGCAGAGGGTCAGTGG + Intronic
954746881 3:52792378-52792400 CAGTCAAAACACAATGTCACAGG + Intergenic
955825507 3:62942464-62942486 TAGTCAAGACACAGGGTCACTGG - Intergenic
958685535 3:97387904-97387926 CAGTCATAGCAGAAGGTGAAGGG + Intronic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
965129191 3:164673044-164673066 CAGTCATAGCTCAGAGACAGAGG - Intergenic
965803837 3:172521991-172522013 CAGTGAGAGCACATGGACACAGG + Intronic
970027063 4:11634950-11634972 CTGTCATAACACAGTGCCACAGG + Intergenic
971118694 4:23679670-23679692 CAATCATTGCAGAGGGTGACAGG - Intergenic
971285418 4:25284687-25284709 CAGTGAGAACACAGGGACACAGG - Intergenic
971740739 4:30517356-30517378 CAGTGAGAACACAGGGACACAGG + Intergenic
973032095 4:45358355-45358377 CAGTCATGGCACAAGGTGAAGGG - Intergenic
973329160 4:48895069-48895091 CAGTCATAGGAAGGGGCCACCGG + Intronic
973556299 4:52086459-52086481 CAGTGATAACACATGGACACAGG - Intronic
973558799 4:52113299-52113321 CATTCATAGCAAAGAGTCATTGG - Intergenic
974578885 4:63768375-63768397 CAGTAATAGTACAAGGTCAAAGG - Intergenic
974666334 4:64967517-64967539 CAGTAATAGCAGAGGGTGAAAGG - Intergenic
975309776 4:72890604-72890626 CAGTGAGAGCACATGGACACAGG - Intergenic
978522890 4:109634996-109635018 CAGTGAGAGCACATGGACACAGG - Intronic
979186175 4:117796762-117796784 AAGTCACACCACAGGATCACAGG + Intergenic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
985799839 5:1998062-1998084 CAGTCATGGCCCATGGTCATGGG + Intergenic
986439025 5:7762399-7762421 CAGTCAGAGCTCAGGGGCCCAGG - Intronic
988308875 5:29531220-29531242 CAGTCATAACAGAAGGTGACAGG + Intergenic
989171088 5:38470672-38470694 TAGTCATGGCAAAGGGTCCCTGG - Intergenic
990943045 5:61222779-61222801 CAGTCATGGCAGAAGGTGACAGG - Intergenic
991537915 5:67693634-67693656 CAGTGAGAACACATGGTCACAGG + Intergenic
992492354 5:77257865-77257887 CAGTGAGAGCACATGGACACAGG - Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994388163 5:99157619-99157641 CAGTGAGAACACAGGGACACAGG - Intergenic
997056699 5:130452302-130452324 CACACACAGCACAGGGTCTCTGG + Intergenic
997171277 5:131723904-131723926 CAGTGAAAACACATGGTCACAGG - Intronic
997199210 5:131999630-131999652 CAGTGGTAGCACAGGCTCCCTGG + Intronic
997743299 5:136276845-136276867 TAGTCATAGCACAGTCTCAGAGG + Intronic
998961448 5:147491233-147491255 CATTCACAGTCCAGGGTCACAGG + Intronic
1001540537 5:172534672-172534694 CAGTCATAGGGCAGGGGCAGGGG - Intergenic
1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG + Intergenic
1006501818 6:34464254-34464276 CAGGCATTGCCCTGGGTCACTGG + Intergenic
1008260856 6:49365581-49365603 CAGTCATAGCAGAAGGTGAAGGG + Intergenic
1008342926 6:50389451-50389473 CAGTCATAGCAATAGGTCATCGG - Intergenic
1009357035 6:62763179-62763201 CAATCATAGCACAAGGTGAAGGG - Intergenic
1009821893 6:68813229-68813251 CAATCATGGCAGAGGGTCAAAGG - Intronic
1010999101 6:82567830-82567852 CAGTTAGAACACAGGGTGACTGG + Intergenic
1011830749 6:91368403-91368425 CAGTGAGAACACAGGGACACAGG - Intergenic
1012452549 6:99368563-99368585 TAGTTATAGCACATGGACACAGG + Intergenic
1012680086 6:102169259-102169281 CAGTGAAAACACAGGGACACAGG + Intergenic
1012696065 6:102385166-102385188 CAGTCAAAGCCCAGTGTCCCTGG + Intergenic
1013211618 6:107992014-107992036 CTGTCATAGCTCAGGTTCCCCGG + Intergenic
1013352331 6:109317122-109317144 CTTTCATTGCACAGGGTCAAGGG - Intergenic
1013995343 6:116301829-116301851 CAGTGATAACACATGGACACAGG - Intronic
1014334683 6:120118261-120118283 CAGTCATAGGACACAGTGACTGG - Intergenic
1016168250 6:140974988-140975010 CAATGAGAACACAGGGTCACAGG + Intergenic
1017201694 6:151761529-151761551 CAGAAATTGCTCAGGGTCACAGG - Intronic
1018273175 6:162102232-162102254 CAGTGAGAACACAGGGACACAGG - Intronic
1019947242 7:4339553-4339575 CAGTCATGGCAGAAGGTCAAAGG - Intergenic
1020853800 7:13391529-13391551 CAGTGAGAGCACACGGACACAGG + Intergenic
1023589850 7:41770289-41770311 CAGTGAGAGCACATGGACACAGG + Intergenic
1023723984 7:43123444-43123466 ATGTCAAAGCGCAGGGTCACAGG - Intronic
1027695582 7:81405603-81405625 CAGTCATGGCAGAGGGTGAGGGG + Intergenic
1027834326 7:83220369-83220391 CAGTAATAGAACTGAGTCACTGG - Intergenic
1029469714 7:100746603-100746625 CAGCCAGAGGACAGGCTCACGGG - Exonic
1030054535 7:105571504-105571526 CAGTCAAAGCACAAGTTGACCGG + Intronic
1033812591 7:145033628-145033650 CACTCATAGCAGAGGGTGAAGGG + Intergenic
1039957821 8:42220845-42220867 CACTCATTGCATAGGGTCCCTGG - Intergenic
1043780273 8:84325351-84325373 CAGTCATAGCAGAGGGTGTTAGG - Intronic
1045318468 8:101063408-101063430 CAGTCACAGTACAGGGTGGCTGG + Intergenic
1045703850 8:104897601-104897623 CAGTGAGAGCACATGGACACAGG + Intronic
1046743150 8:117849361-117849383 CAGGCATAGTACAGGGTCTGGGG - Intronic
1047002577 8:120587526-120587548 CAGTCATTCCACAGGGTCTAAGG - Intronic
1049456585 8:142694768-142694790 CAGTCACAGCCCATGGTCACAGG - Intergenic
1050661293 9:7885843-7885865 CAGTGATAACACATGGACACAGG + Intronic
1055015613 9:71614655-71614677 TAGTCATAGCACAGGTTGGCAGG - Intergenic
1055863555 9:80784876-80784898 GAGTCATAGTCCAGGGTCAGAGG - Intergenic
1055875790 9:80939921-80939943 AAGTCATAGCCCAGGAACACAGG + Intergenic
1056054180 9:82803580-82803602 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1056313359 9:85365281-85365303 CAGTGAGAACACATGGTCACAGG - Intergenic
1058148070 9:101433425-101433447 TAATCATAAAACAGGGTCACAGG + Intronic
1058409867 9:104719844-104719866 CAATCAGAACACATGGTCACAGG + Intergenic
1058841995 9:108918831-108918853 CAGTCCTGCCACAGGCTCACTGG + Exonic
1059889061 9:118780627-118780649 CAGTCATATGACAGGGTATCAGG - Intergenic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1188000347 X:24974600-24974622 CAGTGAGAACACATGGTCACAGG + Intronic
1188398699 X:29718402-29718424 CAGTGAGAACACATGGTCACAGG + Intronic
1189597506 X:42584937-42584959 CAGCCACAGCAAAGGGTGACTGG + Intergenic
1191198413 X:57750051-57750073 CAATGAGAGCACAGGGACACAGG + Intergenic
1191704328 X:64078442-64078464 AAGTTATAGCCCAAGGTCACAGG - Intergenic
1193516517 X:82472285-82472307 CAGTGATAACACATGGACACAGG - Intergenic
1193795165 X:85865372-85865394 CAATCATAGCAGAGGGTGAAGGG - Intronic
1193922193 X:87443317-87443339 CAATGAGAGCACATGGTCACAGG - Intergenic
1194446308 X:93991413-93991435 CAGTGAGAGCACATGGACACAGG + Intergenic
1196214118 X:113030338-113030360 CAGTGATAACACATGGGCACAGG + Intergenic
1198542563 X:137655396-137655418 CATTCATACCACAGGGTCCTTGG - Intergenic