ID: 1094361791

View in Genome Browser
Species Human (GRCh38)
Location 12:29638775-29638797
Sequence CCCTGGCAGGGTGTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 692
Summary {0: 1, 1: 12, 2: 55, 3: 137, 4: 487}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094361791_1094361802 10 Left 1094361791 12:29638775-29638797 CCCCATCACACACCCTGCCAGGG 0: 1
1: 12
2: 55
3: 137
4: 487
Right 1094361802 12:29638808-29638830 ACTCCTCCCGTTTCACCACTAGG 0: 1
1: 0
2: 1
3: 7
4: 89
1094361791_1094361805 16 Left 1094361791 12:29638775-29638797 CCCCATCACACACCCTGCCAGGG 0: 1
1: 12
2: 55
3: 137
4: 487
Right 1094361805 12:29638814-29638836 CCCGTTTCACCACTAGGTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094361791 Original CRISPR CCCTGGCAGGGTGTGTGATG GGG (reversed) Intronic
900002326 1:21578-21600 CCCTGGCAGGGTGTGGGGCAGGG - Intergenic
900022046 1:192102-192124 CCCTGGCAGGGTGTGGGGCAAGG - Intergenic
900099151 1:953696-953718 CCCTGGCCAGGAGTGGGATGTGG + Intronic
900142706 1:1145271-1145293 CCCTGGCAGGGCGTGTCCTCTGG - Intergenic
900186327 1:1334861-1334883 GCCTGGCAGGGTGCAGGATGGGG - Exonic
900188897 1:1345134-1345156 CCCTGGCTGGGTGGGCCATGCGG - Intronic
900586273 1:3433713-3433735 CCCTGGGAGGGGGTGTGGAGAGG - Exonic
900637641 1:3673847-3673869 CCCAGGCAGGGTGCGGGGTGTGG + Intronic
900745457 1:4357617-4357639 CCCTCGCAGGGAGTGTGATGAGG - Intergenic
901512499 1:9724487-9724509 CCCAGGCAGGGTGCAGGATGGGG + Intronic
902138605 1:14333035-14333057 GCCTGTCAGGGAGTGGGATGGGG - Intergenic
902220599 1:14962128-14962150 CCCTGACAAGGGGTGTGATGTGG + Intronic
902290387 1:15431265-15431287 CCCAGGCAGGGTGTGGGAGCTGG + Intergenic
902471458 1:16649537-16649559 ACCTGGGAGGGTGTGAGGTGGGG + Intergenic
902721498 1:18307236-18307258 CCCTGGCAGGGTTGGGGAGGAGG - Intronic
902968371 1:20028840-20028862 CCCTTGCAGGGTGTGCGATGGGG + Intronic
903237910 1:21962215-21962237 CCCTGGCAGGGAAGGTGCTGGGG + Intergenic
903276185 1:22223446-22223468 CACTGGCAGGGTGGGGGAAGAGG + Intergenic
904041999 1:27590499-27590521 CCCAGGCTGGGTGTGTGCTGAGG - Intronic
904435158 1:30490231-30490253 CCCTGGGACAGTGTGTGGTGAGG + Intergenic
904454748 1:30640808-30640830 CCCTGGGAGGGTGCTTGTTGGGG + Intergenic
905558655 1:38908594-38908616 CCCTCGCAGGGCGTGCGATGGGG + Intronic
906910445 1:49943496-49943518 CCCAGTCAGGGTGTGTGTTCAGG - Intronic
907038137 1:51234936-51234958 CCGTGGCAGGGTGTGGGCTTAGG + Intergenic
907526960 1:55059377-55059399 CCCTGGCAGGGACACTGATGAGG + Intronic
907911673 1:58832787-58832809 GCCTGCCTGGGTGTGTAATGGGG + Intergenic
908538779 1:65103326-65103348 CCTTGGCAGCTGGTGTGATGTGG + Intergenic
908908784 1:69047865-69047887 CCCTCGCAGGGCATGTGATGGGG - Intergenic
909818547 1:80027995-80028017 CCCTCGCAGGGCATATGATGGGG - Intergenic
909863052 1:80632993-80633015 CCCTTGCAGGGCATGTGATGGGG - Intergenic
910477255 1:87620412-87620434 CCCTTGCAGGGCATGTGATGGGG - Intergenic
911058503 1:93728223-93728245 CCCTCGCAGGGCGTGTGACAGGG + Intronic
911587276 1:99705225-99705247 CCCTTGCAGGGTGTGGAATGGGG - Intergenic
912560354 1:110547181-110547203 CACTGTCAGGGTGTGGGGTGTGG + Intergenic
913246537 1:116875136-116875158 CCCTTGCAGGGCGCGCGATGGGG + Intergenic
913317317 1:117564022-117564044 GCATGCCAGGGTATGTGATGAGG + Intergenic
914704663 1:150160843-150160865 CCTTGGAAGTGTGTGAGATGAGG + Intronic
914977220 1:152377841-152377863 CCCTTGCAGGGCATGTGATGGGG + Intergenic
915289149 1:154871250-154871272 CCAAAGCAGGGTGTGTGAAGTGG + Intergenic
915922852 1:159990192-159990214 CCCTGGCAAGGGGTGGGGTGTGG - Intergenic
916103532 1:161413070-161413092 CCCTTAAAGGGTCTGTGATGAGG + Intergenic
917554317 1:176067970-176067992 CCCTTGCAGGGTGTGCGATGGGG - Intronic
918024736 1:180732554-180732576 CCCTCACAGGGTGTGCAATGGGG + Intronic
918117356 1:181508669-181508691 CCTTGGCAGGCTGTATGTTGGGG + Intronic
919539641 1:198830929-198830951 CTCTTGCAGGGTGTGTGATGAGG + Intergenic
919873447 1:201842430-201842452 CCCTGTCAGAGGGTGGGATGGGG + Intronic
920065134 1:203263820-203263842 CCCTGGGAAGGTCTGTGGTGCGG + Intronic
920167223 1:204044480-204044502 CCTGGGTAGGGAGTGTGATGGGG + Intergenic
920336077 1:205246282-205246304 ACCTGGCAAGGGGTGTGAGGTGG + Intronic
920352125 1:205344121-205344143 GCCTGGCAGCGTAAGTGATGCGG - Exonic
920385498 1:205568366-205568388 CCCTGGAAGGGCCTGAGATGAGG - Intergenic
920461170 1:206141504-206141526 CCCTCGCAGGATGTGTGATTGGG - Intergenic
921116095 1:212093142-212093164 CCCTTGCAGGGCGTGCGATGAGG + Intronic
921785959 1:219229780-219229802 CCCTCGCAGGGCATGCGATGAGG - Intergenic
921891071 1:220353856-220353878 CCCTCACAGGGCGTGCGATGAGG - Intergenic
921893815 1:220378987-220379009 CCTTCACAGGGTGTGTGATGGGG + Intergenic
921956120 1:220984452-220984474 CCCTCGCAGGGCGTGAGATGGGG - Intergenic
922755872 1:228096720-228096742 CCCTGGAAGGTTCTGTGTTGGGG + Intronic
923046746 1:230361487-230361509 CCCAGGTAGGTGGTGTGATGGGG - Intronic
1062860889 10:808206-808228 TTCTGGCAGGGTTTGTTATGTGG + Exonic
1063359898 10:5444178-5444200 CCTGGGCAGTATGTGTGATGTGG - Intronic
1063460120 10:6210079-6210101 CCTTGCCAGGGAGGGTGATGAGG + Intronic
1064795764 10:19009670-19009692 CCCTTGCAGGGCGTGCGATGGGG + Intergenic
1065778356 10:29143327-29143349 CCCTCCCAGGGCGTGCGATGAGG - Intergenic
1067043937 10:42974178-42974200 TCCTGGCAGGGGATGTGCTGAGG + Intergenic
1067286199 10:44909151-44909173 CCCAGACAGGGTGTGTGCTGAGG - Intergenic
1068134732 10:52940475-52940497 CCCTCGCTGGGCGTGCGATGGGG - Intergenic
1068134862 10:52941288-52941310 CCTTCGCAGGGCGTGCGATGGGG - Intergenic
1068186582 10:53593617-53593639 CCCTGGGATGGAGTGGGATGAGG - Intergenic
1068418742 10:56761757-56761779 CCCTTGCCGGGTGTGTGATAGGG - Intergenic
1068607979 10:59026648-59026670 CCCTCACAGGGCATGTGATGGGG - Intergenic
1069792483 10:71031838-71031860 GCATGGCAGGCTGAGTGATGGGG + Intergenic
1070503162 10:77090345-77090367 CCCTCGCAGGGTGTGTGGTTGGG + Intronic
1070647332 10:78211039-78211061 TGCTGGCAGGGTGTGTGGCGGGG + Intergenic
1070670912 10:78376621-78376643 CCCTGTCAGGCAGTGTGTTGGGG + Intergenic
1071074386 10:81733216-81733238 CCCTCGCAGGGTGTGTGATGGGG - Intergenic
1071107723 10:82117645-82117667 ACCTGGCAGGGTGTGCTGTGAGG + Intronic
1071353157 10:84767070-84767092 TCCTCACAGGGTGTGCGATGGGG + Intergenic
1071486910 10:86108227-86108249 CCCTCGCAGGGTGTGCGATGGGG - Intronic
1071866992 10:89746007-89746029 CCCTCGCAGGGCATGCGATGGGG + Intronic
1072032154 10:91531096-91531118 CCCTTGTCAGGTGTGTGATGGGG - Intergenic
1072392320 10:94999929-94999951 CCCTTGCAGGATGTGTGACAGGG + Intergenic
1072885094 10:99265842-99265864 CCCTGTGAGGGTGTGTGTTTGGG - Intergenic
1073913787 10:108378075-108378097 CCTTGACAGGGTGGGTTATGGGG + Intergenic
1073984517 10:109193280-109193302 CCCTTGCAGGATGTGTGACAGGG + Intergenic
1074865209 10:117540821-117540843 CCCTGGGAAGGTGTGGGGTGGGG + Intergenic
1076825766 10:132967154-132967176 CCCTTGCAGGGTGTGCGATGGGG + Intergenic
1076863448 10:133154636-133154658 CCCTGGCAGGGACAGTGAGGAGG + Intergenic
1076874481 10:133209095-133209117 CCCATGTATGGTGTGTGATGTGG + Intronic
1076999729 11:316466-316488 CACCGGGAGGGTGTGTGCTGCGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077380662 11:2235545-2235567 CCCTCCCAGGGTGGGTGAGGAGG - Intergenic
1077536447 11:3127026-3127048 CCCTGGCAGGCTGGGTAAGGAGG + Intronic
1077608558 11:3628702-3628724 ACCTGGCAGGGGGTGGGATGTGG - Intergenic
1077853384 11:6097054-6097076 GCCTGCCATGGTGAGTGATGGGG - Intergenic
1079091407 11:17482839-17482861 CTTTGGAAGGGGGTGTGATGTGG + Intergenic
1079706865 11:23632362-23632384 CCCTGGCTGGATGGGTGCTGAGG + Intergenic
1081342630 11:41947129-41947151 CCCTCACAGGGCATGTGATGGGG + Intergenic
1083107708 11:60374304-60374326 CCCTTGCAGGGTGCGTGATGGGG - Intronic
1083491161 11:63015925-63015947 CACTGGCAGGGAGAGTGCTGTGG + Intergenic
1084085067 11:66851267-66851289 CCCTTGCAGGTTCTGTGAAGTGG - Exonic
1084187979 11:67485178-67485200 CCCTCGCAGGGCGTGCGATGGGG + Intronic
1084205936 11:67592980-67593002 CCCTTGCAGGGCATGTGATGGGG + Intergenic
1084216536 11:67649982-67650004 CCCTGACAGGCTGTGTGACCTGG + Intronic
1084274967 11:68046654-68046676 CCCTGACAGTGTGTATGTTGGGG + Intronic
1084396505 11:68914387-68914409 CCCTCGCAGGGCGTGGGATGGGG + Intronic
1085315610 11:75543107-75543129 CCCTTGCAGGGCGTGCGATGCGG + Intergenic
1085752586 11:79174626-79174648 CTCTGGCAGGAGGTGTGAGGAGG + Intronic
1086136343 11:83446886-83446908 GCCTGACAGGGTGTGAGGTGGGG + Intergenic
1086286928 11:85261782-85261804 CCCTGACCTAGTGTGTGATGAGG + Intronic
1086455390 11:86955183-86955205 CCCGGGACGGGAGTGTGATGCGG + Exonic
1087261194 11:96014134-96014156 CCCTCGCAGGGTGTGAGATGGGG - Intronic
1087286063 11:96266179-96266201 CCCTCGCAGGGTGTACGATGGGG - Intronic
1087461361 11:98453108-98453130 CCCTAGCAGAGTGTGTGATGGGG + Intergenic
1087981046 11:104615431-104615453 CCCTGGCAGGGCGTGTGACCTGG + Intergenic
1087991326 11:104747466-104747488 CCCTCGCAGGGTGTGTGACAGGG - Intergenic
1088238469 11:107750070-107750092 CCCTCGCAGGGTGTGCGATGGGG + Intergenic
1088507246 11:110538942-110538964 CCCTTGCAGGGTGTGCAATGGGG + Intergenic
1089653823 11:119932873-119932895 GCCTGTCAGGGTGAGGGATGGGG - Intergenic
1089949174 11:122509629-122509651 CCCTTTCAGGGCATGTGATGGGG + Intergenic
1090124237 11:124069478-124069500 CCCTCACAGGGTGTGCGAAGGGG + Intergenic
1091187469 11:133659097-133659119 CCCTGGCAGGATGTGAGGTGTGG - Intergenic
1091229803 11:133981006-133981028 GCCTGGCTGGGAGTGGGATGTGG - Intergenic
1091304979 11:134531035-134531057 GCCGGGCAGGGGATGTGATGTGG + Intergenic
1091325382 11:134683035-134683057 CCCTGACAGGGTGTGTGCACAGG - Intergenic
1091375745 12:23640-23662 CCCTGGCAGGGTGTGGGGCAAGG - Intergenic
1091587127 12:1822737-1822759 CCTGGGCAGTGTGTGTGATGGGG + Intronic
1091714913 12:2770196-2770218 CCCTGCACGGGTGTGAGATGGGG - Intergenic
1091998448 12:5013990-5014012 CTGTGCCATGGTGTGTGATGGGG - Intergenic
1092126728 12:6079905-6079927 GCCTGGCACAGTGTGTGAGGTGG - Intronic
1092178883 12:6431080-6431102 GCCTGGCAGGCTGAGTCATGAGG + Intergenic
1092412843 12:8267580-8267602 CCCTTGAAGGGTATGCGATGCGG + Intergenic
1092569507 12:9707631-9707653 CCCTTGCAGGGCATGTGATGGGG - Intergenic
1092570039 12:9711213-9711235 CCCTTGCAGGGTGTGAGATGGGG - Intergenic
1093509094 12:19904521-19904543 CCCTCACAGGGTGTGTGATGGGG - Intergenic
1094249229 12:28340608-28340630 CCCTTGCAGGGTGTGTAATGGGG + Intronic
1094361791 12:29638775-29638797 CCCTGGCAGGGTGTGTGATGGGG - Intronic
1094523939 12:31219553-31219575 CCCTGGCAGGGTGTGGGGCAAGG - Intergenic
1095234299 12:39778133-39778155 CCCTCGCAGGGTGTGTGATGGGG - Intronic
1095641848 12:44494833-44494855 CTCTCACAGGGTGCGTGATGGGG + Intergenic
1095748170 12:45682520-45682542 CCCTCGCAGGATGTGTGACAGGG - Intergenic
1095898557 12:47305121-47305143 CCCTCACAGGGTGTGTGACGGGG + Intergenic
1096276227 12:50210648-50210670 CCCTGGCAAGGTGTATGCTCTGG - Intronic
1097040414 12:56152939-56152961 CCCTGGCAAGGTTTGTGACCTGG + Intronic
1098377723 12:69835740-69835762 CCCTCACAGGGTGTGTGACAGGG + Intronic
1098396794 12:70028203-70028225 CCCTTACAGGGTGAGCGATGTGG + Intergenic
1098548023 12:71732317-71732339 CCCTCACAGGGTGTGCGATGCGG - Intergenic
1098837220 12:75438077-75438099 CCCTGGACAGGTGTGTGATAGGG - Intergenic
1099499185 12:83389852-83389874 CCCTCGCAGGGCGTGGGATGGGG - Intergenic
1100641353 12:96484763-96484785 CCCTTGCAGGGCGTGCGATGGGG - Intergenic
1101204917 12:102476997-102477019 CCCTGACAGGGTGTTAGGTGAGG + Intronic
1101455809 12:104828637-104828659 CCCTCACAGGGCATGTGATGGGG - Intronic
1101574498 12:105985037-105985059 CCCTTCCAGGGTGTTTGATAGGG - Intergenic
1102271933 12:111544589-111544611 AGCTGGCAGTGTGTGTCATGTGG + Intronic
1102686565 12:114729362-114729384 TGGTGGCAGGGTGTGTGGTGTGG + Intergenic
1103224439 12:119274775-119274797 CCCTCTCGGGGTGTGCGATGGGG - Intergenic
1103848522 12:123916115-123916137 CCCTGGCAGGCTGAGGGAAGAGG - Intronic
1104247965 12:127061196-127061218 CCCTTGCAGGGCGTGCGATGGGG - Intergenic
1104926476 12:132316594-132316616 CCCTGGCAGGAGGAGGGATGAGG - Intronic
1105682581 13:22744700-22744722 CCCTTGCAGGGCATGCGATGGGG + Intergenic
1106015988 13:25869697-25869719 CCCTGGCAGGGCGTGTGAGAGGG + Intronic
1106111974 13:26785457-26785479 CCCTCGCAGGGCGTGCGATGGGG + Intergenic
1106235305 13:27856286-27856308 CCCTCGCACGGCGTGCGATGGGG + Intergenic
1106541043 13:30690436-30690458 CCCTCGCAGGACGTGCGATGAGG - Intergenic
1106618629 13:31353157-31353179 CCCTTGCAGGGTGCACGATGCGG - Intergenic
1107689206 13:42935056-42935078 CCCTGGCAGTGTGGCTGAGGTGG - Intronic
1109133013 13:58611745-58611767 CTCTTGCAGGGCGTGCGATGGGG - Intergenic
1109140838 13:58712453-58712475 CCCTTGTAGGGTGTGTGACGGGG - Intergenic
1109151652 13:58856229-58856251 CCCTCGCAGGGCATGCGATGGGG + Intergenic
1109152380 13:58860554-58860576 CCCTCGCAGGGCTTGCGATGGGG + Intergenic
1109651238 13:65330396-65330418 CCCTCGCAGGGCGTGTGATGGGG + Intergenic
1109735987 13:66484418-66484440 CCCTCGCACGGTGTGTGATGTGG - Intronic
1109784602 13:67156898-67156920 CCCCGGCAGGGCATGCGATGTGG - Intronic
1111197989 13:84898468-84898490 CCCTCGCAGGGCGTGAGATGGGG + Intergenic
1111262570 13:85760911-85760933 GCCTGGCAGGGCGTGAGATGGGG + Intergenic
1111413876 13:87912842-87912864 CCCTCGCAGGGCGTGTGACAGGG - Intergenic
1111430663 13:88145138-88145160 CCCTCACAGGGTGTGCGATGTGG - Intergenic
1111542138 13:89682733-89682755 GCCTGGTAGGGTGTGGGATGAGG + Intergenic
1113618528 13:111697469-111697491 TCCTGGCTGGCTGTGAGATGGGG + Intergenic
1113624057 13:111782730-111782752 TCCTGGCTGGCTGTGAGATGGGG + Intergenic
1114533307 14:23408564-23408586 CCATGGCAGGGTGGGAGAGGCGG - Intergenic
1115123943 14:29970859-29970881 CCCTCGCAGGGCGTGCGATGGGG + Intronic
1115979077 14:39029915-39029937 CCCTGGCAGGGTGTACGATGGGG + Intergenic
1116345314 14:43786093-43786115 CCCTCGCAGGGTGTGTGACAGGG + Intergenic
1117032614 14:51689726-51689748 CTCCTGCAGGGCGTGTGATGAGG + Exonic
1118487249 14:66225442-66225464 CCCTTGCAGGGTGTGTGACAGGG - Intergenic
1118929402 14:70226000-70226022 CCCTAGAAGGGTGTGCGATGGGG - Intergenic
1119697558 14:76725856-76725878 CCCTTGCAGGGCGTGCGATGGGG + Intergenic
1121014400 14:90539512-90539534 GCCTGGCAGGGTCAGTGCTGAGG + Exonic
1121435907 14:93919245-93919267 CCCTGGCAGGGTTGATAATGAGG - Intronic
1121436980 14:93926781-93926803 TCCTGGCAGGGAGGGTGGTGGGG + Intronic
1122207607 14:100155910-100155932 GCCTGGCTGGGTCTCTGATGGGG + Intronic
1122371092 14:101229416-101229438 CTCTCGCAGGGCGTGCGATGGGG + Intergenic
1122371967 14:101233952-101233974 AGCAGGCAGGGTGTGTGGTGGGG - Intergenic
1122632038 14:103111604-103111626 CCCTGGCAGGGTGGGGCAGGTGG + Intergenic
1122956131 14:105072240-105072262 CCCTGGAAGAGCGAGTGATGTGG - Intergenic
1202905238 14_GL000194v1_random:67939-67961 CCCTGAAAGAGGGTGTGATGTGG + Intergenic
1123663764 15:22589923-22589945 CTCCTGTAGGGTGTGTGATGAGG - Intergenic
1124317595 15:28684372-28684394 CTCCTGCAGGGCGTGTGATGAGG - Intergenic
1124565850 15:30813138-30813160 CTCCTGCAGGGCGTGTGATGAGG + Intergenic
1125463164 15:39925291-39925313 GCATGTGAGGGTGTGTGATGGGG - Intergenic
1125764853 15:42127725-42127747 CCCCTGCAGGGCGTGCGATGGGG - Intergenic
1126475594 15:49062599-49062621 CCCTTGCAGGGCATGTGATGGGG + Intergenic
1126981973 15:54254996-54255018 TCCTTGCAGGGCGTGTGATGGGG + Intronic
1127288089 15:57547803-57547825 TCTTGGCAGGGGGAGTGATGAGG - Exonic
1127517570 15:59710896-59710918 CCCGGGCTGGGGGTGTGATAAGG + Intergenic
1127647670 15:60974432-60974454 ACCTGGCTGGCTGTGTGAAGGGG - Intronic
1129079844 15:73029537-73029559 CCCTGGAAGGGTGTGTGATCTGG + Intergenic
1129320053 15:74769621-74769643 TCCTGGCAGGGAGTTAGATGAGG - Intergenic
1130077287 15:80700137-80700159 CCCTGGAAGGATGTGTGTTGAGG - Intronic
1130171849 15:81523150-81523172 CCCTTGCAAGGTGTGTGACAAGG + Intergenic
1130678916 15:85979447-85979469 CCCAGGCAGGGAGTGAGCTGGGG - Intergenic
1130682646 15:86010139-86010161 CCCTTGCAGGGTGTGCAGTGGGG + Intergenic
1131601893 15:93857730-93857752 TTCTGGCAGGGTGTGTCAAGAGG + Intergenic
1131691522 15:94832266-94832288 TCCTCGCAGGGCGTGTGATGGGG - Intergenic
1132345330 15:101104770-101104792 CCCTGCCAGGGTGTGGCCTGTGG - Intergenic
1132415480 15:101615867-101615889 CCCTGGGAGGGTCTGAGCTGTGG - Intergenic
1132451185 15:101969361-101969383 CCCTGGCAGGGTGTGGGGCAAGG + Intergenic
1132462083 16:60513-60535 CGCTGGCAGTGTGGGTGAAGTGG - Exonic
1132551517 16:555695-555717 ACCTGGCAGGGTCTGTGCTGTGG - Intergenic
1132595403 16:746824-746846 CCCTAGCCCTGTGTGTGATGGGG - Intronic
1133409755 16:5558449-5558471 CCCTGGCAGGATGTGTGACAGGG - Intergenic
1133721001 16:8494262-8494284 CTCTTGCAGTGTGTCTGATGTGG + Intergenic
1133823955 16:9260674-9260696 GCCTGGCATGTTGTGTGCTGGGG + Intergenic
1134081563 16:11328380-11328402 CCCTGCCAGGAGGTTTGATGTGG - Intronic
1134346550 16:13397246-13397268 CCCTGGCAGGGCTTGTAATGGGG + Intergenic
1134535943 16:15027231-15027253 CCCTCGCAGGGCATGTGATGGGG + Intronic
1134824803 16:17275853-17275875 CTGTGGCAGGGTGTGTGTGGGGG - Intronic
1135862204 16:26066943-26066965 CATTGGCAGGGTCTGTGCTGTGG + Intronic
1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG + Intergenic
1136288043 16:29255429-29255451 CACTGGGAGGGTGTGGGCTGTGG + Intergenic
1137599149 16:49744298-49744320 GCCTGGCTGTGTGTGTGCTGAGG - Intronic
1137700677 16:50495677-50495699 CCCAGGAAGGAGGTGTGATGTGG + Intergenic
1138128272 16:54456640-54456662 TCCTTGCAGGGTGTGTGATGGGG + Intergenic
1138210851 16:55162169-55162191 CCATTGCAGGGTGGGAGATGAGG - Intergenic
1138808546 16:60121340-60121362 CCCTCGCAGGGCATGCGATGGGG - Intergenic
1139672655 16:68502264-68502286 CCCTGGAAGTGTTTGTGAAGGGG - Intergenic
1139860112 16:70013556-70013578 CCCTCGCAGGGCATGTGATGGGG - Intergenic
1140041752 16:71412764-71412786 CCATGTCAGGGTGAGTGCTGGGG + Intergenic
1140110350 16:71998736-71998758 GCCTGGCAGGGTGGGTGTGGTGG - Intronic
1140421744 16:74824877-74824899 ACCTGGGAGGGTTTGTGCTGTGG + Intergenic
1140614734 16:76648747-76648769 CCCTGGCAGGGCATGCGATGAGG + Intergenic
1140616363 16:76669117-76669139 CCCAGGCTGGGGGTGGGATGGGG - Intergenic
1140933941 16:79653465-79653487 CCCTGGGAGAGTGGCTGATGAGG + Intergenic
1141089038 16:81117421-81117443 CCCTGGCGGTGTTTGTGAAGAGG - Intergenic
1141642540 16:85349602-85349624 CGCTGGCAGGGTGTGTGCATTGG - Intergenic
1142093709 16:88228196-88228218 CACTGGGAGGGTGTGGGCTGTGG + Intergenic
1142274132 16:89107052-89107074 ATCTGGCAGGGTCTGTGCTGTGG + Intronic
1142890773 17:2941034-2941056 CCCTGGCAGGGTGTGGGTAGTGG + Intronic
1144300924 17:13922577-13922599 CCCTCACAGGGTGTGTGACATGG - Intergenic
1144371483 17:14595821-14595843 CCTTCACAGGGTGTTTGATGTGG - Intergenic
1144783668 17:17820187-17820209 CCCTGGCAGGGGCTGTGGGGTGG + Exonic
1145057018 17:19709305-19709327 ACGTGGCAGTGTGTGTGTTGGGG + Intronic
1145232714 17:21186275-21186297 CACTGGCAGGGTAAGTGATGTGG + Intronic
1146282459 17:31553632-31553654 TCCTGGCAGTGTGTCTGTTGAGG + Intergenic
1146750374 17:35373417-35373439 CCCAGCCAGGGTGTGGGGTGTGG - Intronic
1147140018 17:38455525-38455547 TCCAGGCAGGATGTGTGCTGGGG + Intronic
1147256816 17:39186496-39186518 CACTGGCAGGGGGTGTGGGGCGG + Exonic
1148115410 17:45172191-45172213 CCCAGCTAGGGCGTGTGATGTGG - Intergenic
1149318306 17:55459177-55459199 CCCTCTCAGGGCGTGTGATGGGG - Intergenic
1149455407 17:56783978-56784000 GCCTGTCAGGGGGTGGGATGGGG - Intergenic
1149882656 17:60308415-60308437 CCCTCACAGGGTGTGTGATGGGG - Intronic
1150445063 17:65222366-65222388 CCCAGTCAGGCTATGTGATGAGG - Intronic
1150855548 17:68748968-68748990 GCCTGTCAGGGAGTGGGATGTGG - Intergenic
1150856485 17:68758204-68758226 GCCTGTCAGGGAGTGGGATGTGG + Intergenic
1151329500 17:73398491-73398513 CCCTGGCAGGGCTTGTACTGGGG - Intronic
1151552839 17:74831897-74831919 CCCTGCCAGGATGCGCGATGGGG - Intronic
1151930207 17:77227517-77227539 CCGTGGCAGGGGGTGAGAGGAGG - Intergenic
1151953279 17:77367077-77367099 GCCAGGCAGAGGGTGTGATGGGG + Intronic
1152376623 17:79921937-79921959 GCCGGGCAGGGTGGGTGCTGCGG - Intergenic
1152706440 17:81846048-81846070 CCCGGGCAGGGTGAGGGTTGGGG - Intronic
1152735563 17:81995357-81995379 CCCTGGCTGGGGCTGTGACGGGG + Intronic
1153990422 18:10394372-10394394 CCCTTGCAGGGTGTGTGATGGGG + Intergenic
1154437296 18:14356931-14356953 ACTTGGCAGGGCGTGTGGTGGGG + Intergenic
1156439205 18:37167083-37167105 CCCTCGCAGGTTGTGTAATGGGG + Intronic
1156624207 18:38888820-38888842 GTCTGGTATGGTGTGTGATGGGG + Intergenic
1156676242 18:39530042-39530064 CCCTGGCAGGGTGTGCGATGGGG - Intergenic
1156766443 18:40662608-40662630 CCCTCACAGGGCGTGTGGTGGGG + Intergenic
1157762708 18:50275968-50275990 TCCTGGCAGCGTGTGGGCTGTGG - Exonic
1158015075 18:52774609-52774631 CCCTCGCAGAGTGTGTGATGGGG + Intronic
1158015168 18:52775171-52775193 CCCTCGCAGGGTGTGTGACATGG + Intronic
1158180709 18:54712547-54712569 CCCTAGCAGGGTGTGTGATGGGG + Intergenic
1158523809 18:58194600-58194622 CCCTGGCAGGGTTTGGGCTGTGG + Intronic
1159215308 18:65384315-65384337 CCCTTTCAGGGAGTGTGATGGGG - Intergenic
1160634078 19:63186-63208 CCCTGGCAGGGTGTGGGGCAGGG - Intergenic
1161210664 19:3063554-3063576 CCCTGGAAGGCTGTGGGAGGAGG + Intergenic
1161352853 19:3803487-3803509 CCCTGGCAGTGTTTGGGACGGGG - Intergenic
1161381326 19:3966605-3966627 CCCTGGCAGAGTGAATGACGGGG - Intronic
1161779608 19:6282738-6282760 GCCTGTCAGGGGGTGTGGTGGGG + Intergenic
1162011081 19:7815481-7815503 CCCTTGCAGGGCGTGTGACGGGG + Intergenic
1162311865 19:9912783-9912805 CCCAGGGAGGGTGAGTTATGGGG + Intronic
1162410507 19:10502684-10502706 CCATGGCGGGGTGAGTGAGGCGG - Intronic
1163617200 19:18336453-18336475 CCCTCGCAGGGTGGGCGATGGGG - Intergenic
1163659768 19:18569690-18569712 CCCTGGGAGTGTGTCTGATGGGG - Intergenic
1165229479 19:34377907-34377929 CCCTGGCCCTGTGTGTGTTGGGG + Intronic
1165295770 19:34925031-34925053 CCCTGGCAGGGCGTGCGATGGGG + Intergenic
1165330514 19:35139086-35139108 CCCTGGCAGGGTGTGGAGTTGGG + Exonic
1167446147 19:49538793-49538815 CCCTTGGAGGGTGTTTGCTGGGG + Intronic
1167507561 19:49878836-49878858 CCCTGCCAGGGTGCAAGATGTGG + Intronic
1167683266 19:50939089-50939111 GGCTGCCAGGGTGTGTGGTGTGG - Intergenic
1168355449 19:55697074-55697096 CCCAGGCCGGGTGTGAGAAGAGG - Intronic
925092774 2:1168497-1168519 CCCTTGCAGGGCTTGTGATGGGG - Intronic
925574806 2:5349619-5349641 CCTGGGGAGGGTGTGTGCTGGGG + Intergenic
925839878 2:7980849-7980871 CCCAGGCAGGGTGTGTGACAGGG - Intergenic
926010968 2:9407653-9407675 GCCTGGGAGGGTGTGTCATCAGG - Intronic
926125064 2:10266976-10266998 CCCAGGCAGGGCTTGAGATGTGG - Intergenic
926961634 2:18364282-18364304 CCCTCACAGGGTGTGTGATGGGG + Intergenic
927333400 2:21892212-21892234 CCCTGGCACCGTGTGGGTTGCGG - Intergenic
927432849 2:23041668-23041690 CCCTGTGAGGGTGTGGGATGAGG - Intergenic
928783281 2:34850533-34850555 CCCTGGCGGGGTGGGGGGTGGGG - Intergenic
929681236 2:43995643-43995665 CCCTGGTAGGGAGCGTGGTGCGG + Intronic
930022085 2:47007678-47007700 CCCTGGCAGGGAGGGGGAAGAGG + Intronic
930398119 2:50848231-50848253 CCCTCGCAGGGCGTGCGATGGGG - Intronic
930827730 2:55711162-55711184 GCCTGTCAGGGTGTGGGGTGGGG - Intergenic
931470109 2:62531311-62531333 CCCTCGCAGGGCGTGAGATGAGG + Intergenic
932427082 2:71644935-71644957 CCCTTGCAGGGTGTGCAGTGGGG + Intronic
932569824 2:72932760-72932782 CCCTGGCAAGGTATGGGGTGGGG - Intronic
932778565 2:74544887-74544909 CCCTGGGAGATTCTGTGATGGGG - Intronic
933573498 2:84040612-84040634 GCTTGGCAGGGTGGGTGAGGAGG + Intergenic
934525610 2:95049752-95049774 GGCTGGCAGGGTGTGTGTGGAGG + Intronic
934655303 2:96114251-96114273 CCCTGGCAGGCGCTGGGATGGGG - Exonic
934791702 2:97067732-97067754 CCCTTGCAGGACTTGTGATGGGG + Intergenic
934902500 2:98171890-98171912 CCCTTGCAGGATGTGTGATGGGG + Intronic
934957189 2:98632350-98632372 ACCTTTCAGGGCGTGTGATGGGG - Intronic
935297743 2:101665454-101665476 CCCTCGCAGGGTGTGTGATGGGG + Intergenic
935663940 2:105494154-105494176 CTCTCTCAGGGTGTGCGATGGGG + Intergenic
935759856 2:106310746-106310768 TCCTGGCAGGGTGGTTGATGTGG + Intergenic
936567400 2:113591842-113591864 CCCTGGCAGGGTGTGGGGCAAGG + Intergenic
936933525 2:117814964-117814986 CCCCTGCAGCGTGTGTGATTGGG + Intronic
937648698 2:124296385-124296407 CTCTGTAAGGGTGTGTGCTGTGG - Intronic
937664129 2:124464844-124464866 CACTGGCTGGGTGTTTGCTGAGG - Intronic
937743656 2:125386131-125386153 CTCTCGCAGTGTGTGCGATGAGG + Intergenic
937820707 2:126307749-126307771 CCCTCGCAGGACGTGAGATGGGG + Intergenic
937873624 2:126804026-126804048 CTCTTGCAGGGTGTGAGATGGGG + Intergenic
938923780 2:136020000-136020022 CCCTGGCACGGTCTGTGTGGTGG - Intergenic
938942719 2:136182895-136182917 CTCTGGCTGGCTGTGTGGTGTGG + Intergenic
939216935 2:139250642-139250664 GCCTGTCAGGGGGTGTGGTGGGG + Intergenic
939587311 2:144020697-144020719 CCCTCCCAGGGTGTGTGATGGGG - Intronic
939818935 2:146931338-146931360 CCCTTGCAGGGCATGTGATGTGG - Intergenic
939999404 2:148951785-148951807 CCCTGGGAGTGTGTGTTGTGTGG + Intronic
940445932 2:153777639-153777661 CCCTCGCAGGGTGTGCAATGGGG + Intergenic
941125263 2:161576680-161576702 CCCACACAGGGCGTGTGATGGGG - Intronic
941309674 2:163912982-163913004 CCCTCGCAGGGTGTGTGACAGGG - Intergenic
941325556 2:164109674-164109696 CCCTGGCAGGGTGTGCGATGGGG - Intergenic
941974450 2:171387346-171387368 CCCTCGCTGGATGTGCGATGGGG - Intronic
943128515 2:183827066-183827088 ACATGGCTGGGGGTGTGATGGGG + Intergenic
943749127 2:191493718-191493740 CCCTCGTAGGATGTGTGATAGGG + Intergenic
943838824 2:192551892-192551914 CCCTTGCAGGGTGTGCGACAGGG + Intergenic
943906471 2:193505811-193505833 CCTTCACTGGGTGTGTGATGGGG + Intergenic
944728296 2:202494933-202494955 TCCTGACAGGGTGCGTGATGCGG + Intronic
946385742 2:219383378-219383400 GCCTGGCAGAGGGTGTGGTGGGG + Intronic
947619094 2:231577190-231577212 CCCGGGAAGGGTCTGTGCTGAGG + Intergenic
948631967 2:239308122-239308144 CCCAGGGAGGGTGAGTGATGGGG - Intronic
948670645 2:239566551-239566573 CTGTGGGAGGGTGTGTGAGGAGG + Intergenic
948690742 2:239702429-239702451 TCTTGGCAGGGGGTGTGAAGTGG - Intergenic
948725765 2:239933046-239933068 CCGTGGCAGGGCCTGGGATGGGG + Intronic
1168808765 20:689064-689086 GGCTGGCTGGGTGTGCGATGCGG + Intergenic
1169557637 20:6767760-6767782 CCCCGGCGGGGTGTGGGAAGCGG - Exonic
1169663430 20:8006207-8006229 CCCTCACAGGGTGTGCGTTGGGG - Intronic
1170704559 20:18733425-18733447 CTCTGGCAGTGTCTGTGGTGGGG + Intronic
1170731307 20:18978325-18978347 CCATGGCAGGGGGTGTGGGGAGG - Intergenic
1172026691 20:31953522-31953544 TCCTGGCTTGCTGTGTGATGAGG - Intergenic
1172585112 20:36077803-36077825 CCCTCGAAGGGTGTGCAATGGGG + Intergenic
1172632181 20:36385946-36385968 CCAGGGTAGGGTGTGTGAGGAGG - Intronic
1173421672 20:42906719-42906741 CCCTCACAGGGTGTGTGATGGGG - Intronic
1174069077 20:47887428-47887450 CCCTGGCAAGGCCTGTGATGTGG + Intergenic
1174358837 20:50015476-50015498 CCTTGGCAGGGTGGCTGTTGGGG + Intergenic
1175128167 20:56767954-56767976 CACTGAGAGGGTATGTGATGAGG + Intergenic
1175284335 20:57827827-57827849 CCCTGACAGGCTGGGGGATGGGG + Intergenic
1176071750 20:63230545-63230567 CCCTTGCAGGGCCTGCGATGGGG + Intergenic
1176089741 20:63313517-63313539 CCCTGGCAGGTGGCGTGGTGTGG + Intronic
1176993374 21:15524201-15524223 CCCTTGCAGGGTGTGTGGTGGGG - Intergenic
1177264539 21:18765459-18765481 CCCTCGCAGGGTGTGTGATGGGG - Intergenic
1177639846 21:23832880-23832902 CCCTCGCAGGGCGTGCAATGGGG + Intergenic
1177640189 21:23835250-23835272 CCATGGGAGGGAGTGTGAAGGGG - Intergenic
1177644865 21:23887805-23887827 CCCTTGTAGGGTGTGCAATGGGG - Intergenic
1178384580 21:32138808-32138830 CCCTCACAGGGTGTGTGACAGGG - Intergenic
1178438737 21:32581637-32581659 CCCTCGCAGGGTGTGCGATGGGG - Intronic
1178908370 21:36654478-36654500 CCCTGGCCGGGAGAGTGATGTGG - Intergenic
1179246622 21:39638840-39638862 TCCTCCCAGGGCGTGTGATGGGG - Intronic
1179342329 21:40523949-40523971 CCCTCTCAGGGTGTGTGATGGGG - Intronic
1179507472 21:41851485-41851507 CCCTGGCAGGGTCAGGGAGGAGG + Intronic
1179544196 21:42103645-42103667 GCCTGGCCTGGTGTGTGCTGGGG - Exonic
1179918112 21:44491064-44491086 CCCTCGCAGGGTGTGCGATGGGG - Intergenic
1180571810 22:16730313-16730335 TACTGGCAGGGTGTGTACTGGGG + Intergenic
1180839547 22:18952819-18952841 CCCTAGCAGTGTGTGTGAGAAGG + Intergenic
1180892028 22:19296382-19296404 CCCTTGCAGGGCATGCGATGGGG + Intergenic
1180936975 22:19632317-19632339 GCCTTGCAGGGTGTGGGATGGGG + Intergenic
1180942421 22:19668003-19668025 CCCTCGCAGGGCGTGCGATGGGG - Intergenic
1181062356 22:20287660-20287682 CCCTAGCAGGGTGTGTGAGAAGG - Intergenic
1181368032 22:22394847-22394869 CCCAGGGAGGCTGTGTGCTGTGG - Intergenic
1181646829 22:24235896-24235918 GCCTGGCAGGGTGGGCGAGGTGG - Intronic
1182095260 22:27621512-27621534 CCCTGGCAGGGAGTGAGTAGGGG + Intergenic
1182380434 22:29883285-29883307 CCCTGGCAGGGAGCCTGGTGGGG + Exonic
1182762668 22:32735137-32735159 CCCTGGCTCTGTGTGTGTTGAGG + Intronic
1182778350 22:32847906-32847928 CTCTATCAGGGGGTGTGATGAGG - Intronic
1183264641 22:36817657-36817679 CCCTGGCCAGATGTGGGATGGGG - Intronic
1183292246 22:37010068-37010090 GGCTGGCAGGTTGGGTGATGGGG - Intergenic
1183360962 22:37383312-37383334 GCCTGGCCGTGTGTGTGAAGGGG - Intronic
1183469289 22:37997107-37997129 CCTGGGGAGGGTGTGTGCTGTGG + Intronic
1183782903 22:40009959-40009981 CCCAGGCAGGATGTCAGATGAGG + Intronic
1184098463 22:42329265-42329287 CCTTGGCAGCCTGTGTGCTGGGG - Intronic
1184932485 22:47691615-47691637 GGCTGGCAGAGTGTGTGGTGTGG + Intergenic
1184934068 22:47706251-47706273 CTGTCACAGGGTGTGTGATGCGG + Intergenic
1185127010 22:49016920-49016942 CCTTCGCAGGACGTGTGATGGGG + Intergenic
949422258 3:3878471-3878493 ACTTGGCAGGGTGTGTGTGGTGG - Intronic
949444191 3:4115613-4115635 CCCTCGCAGAGGGTGCGATGCGG - Intronic
949808196 3:7978118-7978140 CCCTTGCAGGGTGTGTGACAAGG + Intergenic
949828254 3:8185698-8185720 CCCTTGCAGGGCGTGTGATGGGG + Intergenic
950471814 3:13191009-13191031 CCATGGCAAGGGGTGTGTTGGGG - Intergenic
950474600 3:13207464-13207486 CTCTGGCGGGTTGTGTCATGGGG - Intergenic
950538396 3:13595006-13595028 CCCCGGCTGGGTGTGTGGTCTGG + Intronic
952298728 3:32085292-32085314 CCCTCACAGGGCATGTGATGGGG + Intergenic
952580308 3:34824916-34824938 CCCTCACAGGGTGTATGATGGGG - Intergenic
953389489 3:42526168-42526190 CCCTGACAGGGTATGGGAGGAGG + Intronic
954082967 3:48223381-48223403 GCCTGCCAGGGTGTGGGCTGGGG - Exonic
954297970 3:49684704-49684726 ACCTGGGAGGGTGTGAGGTGGGG - Intronic
954689796 3:52389611-52389633 CCCAGGCAGGGCCTGTGGTGTGG + Intronic
954736523 3:52712298-52712320 CCCTCGCAGGGCGTGCAATGGGG + Intronic
954922410 3:54203252-54203274 CCCTCGCAGGGCGTGCGATGGGG + Intronic
955480631 3:59385778-59385800 CCCTTGCAGGGCGTGCGATGGGG - Intergenic
956366554 3:68509786-68509808 CCCTGGCAGTGTCTGTTCTGGGG - Intronic
956928065 3:74010672-74010694 CCCTGGTAGGGGGTGGGAGGTGG + Intergenic
957106381 3:75894159-75894181 TACTGGCAGGGTGTGTACTGGGG - Intergenic
957991108 3:87628220-87628242 CCCTCGCAGGGCATGTGATGGGG - Intergenic
958074397 3:88657577-88657599 CCCTTACAGGGTGGGTGATGGGG + Intergenic
958632959 3:96704286-96704308 GCCTCGCAGGGCATGTGATGGGG - Intergenic
959528800 3:107408609-107408631 CTCTGGCAGGGTGAGTGGTGTGG - Intergenic
959574966 3:107924815-107924837 CCCTTGCAGGGTGTGTGACAAGG + Intergenic
959583067 3:108001697-108001719 CCCTGGCAGGGCTTGAGAAGTGG - Intergenic
959583503 3:108004815-108004837 CCCTCGCAGGGCATGTGATGGGG - Intergenic
960062762 3:113340548-113340570 CCCTCGCAGGGTGTGCGATGGGG + Intronic
960515169 3:118595413-118595435 CCCTCACAGGGTGTGTGATGGGG + Intergenic
961295499 3:125880943-125880965 CCCTCGAAGGGCATGTGATGGGG - Intergenic
961433979 3:126903705-126903727 CACTGGCAGGGTGTGGGAGGAGG - Intronic
962095039 3:132284807-132284829 CCCTCGCAGGGCGTGTGACGGGG + Intronic
962274777 3:134003707-134003729 CCATGGCAGTGTTTTTGATGTGG + Intronic
963601277 3:147380899-147380921 CCCTGACAGGGTGTGTGATTGGG - Intergenic
963996954 3:151721042-151721064 CCCTCACAGGGTGTGCGATGGGG + Intergenic
965185210 3:165454525-165454547 CCCTCCTAGGGTGTGTGATAGGG + Intergenic
965321077 3:167251522-167251544 CCCTCACAGGGCGTGCGATGGGG - Intronic
965433084 3:168612945-168612967 CCCTGGCAGGGCGTGCGATGGGG - Intergenic
966217749 3:177520282-177520304 CTCTTGCAGGGTGTGCAATGGGG - Intergenic
968311127 3:197683812-197683834 CCCTGGTTGGGTCTATGATGTGG + Intronic
968921058 4:3522563-3522585 CCCAGGCAGGGAGTGTGGGGTGG - Intronic
968921069 4:3522597-3522619 CCCAGGCAGGGGGTGTGGGGCGG - Intronic
968921082 4:3522631-3522653 CCCAGGCAGGGGGTGTGGGGCGG - Intronic
968921096 4:3522665-3522687 CCCAGGCAGGGGGTGTGGGGCGG - Intronic
968921109 4:3522699-3522721 CCCAGGCAGGGGGTGTGGGGCGG - Intronic
968921123 4:3522733-3522755 CCCAGGCAGGGAGTGTGGGGCGG - Intronic
969285920 4:6201680-6201702 CCGAGGCAGGATGTATGATGTGG - Intergenic
970163718 4:13214716-13214738 GCCTGGCTGGGAGTGAGATGAGG - Intergenic
970233337 4:13933379-13933401 CACTAGCAGGGTGTGTGATGGGG + Intergenic
970273103 4:14368132-14368154 CCCTCACAGGGTGTGCGATGGGG + Intergenic
970697506 4:18695856-18695878 CCCTCACAGGGTGTGTGATGGGG + Intergenic
972940270 4:44186699-44186721 CCCTGGCAGGGCATGTGATGCGG - Intronic
973044454 4:45518974-45518996 CCCTGGCAGGGAGTGTGCCAGGG + Intergenic
973057394 4:45678456-45678478 CCCTTGTAGGGCATGTGATGGGG + Intergenic
974669654 4:65013796-65013818 CCCTTGCAGGGCATGCGATGGGG + Intergenic
974752117 4:66154688-66154710 CTCTCGCAGTGTGTGTAATGGGG - Intergenic
974785188 4:66610011-66610033 CCCAGTGAGGGTGTGTGTTGAGG + Intergenic
974962762 4:68724477-68724499 CCCTGGCAGGATGTGTGACAGGG + Intergenic
975242854 4:72082001-72082023 CCTTGTCAGGGAGTGGGATGAGG + Intronic
976664301 4:87573448-87573470 CACTGGCTGGGTGGGTGAAGAGG + Intergenic
976854767 4:89590680-89590702 CACTGGTAGGTTGTGTGAAGAGG - Intergenic
976877324 4:89869906-89869928 CCTTGCCAGGGCGTGCGATGGGG - Intergenic
976963225 4:91003997-91004019 CCCAGTCAGGGTGTGTGTTCAGG + Intronic
977766549 4:100805672-100805694 CCCTCACAGGGTGTGCGATGGGG + Intronic
979140230 4:117162902-117162924 CCCTTGCAGGGTGTATGATGGGG - Intergenic
979187817 4:117820395-117820417 CTCTGGCAGGGTTTCAGATGGGG + Intergenic
980716541 4:136636820-136636842 CCTTTGCAGGGAGTGTGATGGGG - Intergenic
980734546 4:136867774-136867796 CCCTCACAGGACGTGTGATGGGG - Intergenic
980984484 4:139682484-139682506 GCCTGGCAGGGAGTGGGAGGAGG + Intronic
981906120 4:149923748-149923770 CCCTCGCAGGGTGTGTAATGGGG + Intergenic
982315165 4:154024319-154024341 CCCTCGCAGGGCACGTGATGGGG - Intergenic
982325753 4:154126908-154126930 CCCTCGCAGGATGTGTGACAGGG + Intergenic
982630435 4:157823737-157823759 CCCTGTAAGGGTGTGTGTTCCGG - Intergenic
983145906 4:164214883-164214905 CCCTTGCAGGGCGTGCGATGGGG + Intronic
983717734 4:170805634-170805656 TCCTTGCAGGGCGTGTGATGGGG - Intergenic
984261301 4:177445685-177445707 CCCTTGCAGGGCGTGTGATGGGG - Intergenic
984263543 4:177470430-177470452 CCCTCGCAGGGCGTGCGATGGGG + Intergenic
984289793 4:177781269-177781291 CCCTCGAAGGGTGTGTGACAAGG + Intronic
985054618 4:186025582-186025604 CCTTGGCAGAGTGTGAGAGGAGG + Intergenic
985358717 4:189148861-189148883 CCCAGGCAGAGCCTGTGATGAGG + Intergenic
985653071 5:1115964-1115986 TCCTGGCAGGGTGGGGTATGTGG + Intergenic
986165209 5:5267083-5267105 CCCTCGCAGGGTGTGCGATGAGG + Intronic
986230896 5:5864185-5864207 CCCTTGCAGGATGTGTGACAGGG + Intergenic
986365269 5:7022688-7022710 CCCTCACAGCGTGTGTGATGGGG + Intergenic
986484073 5:8217643-8217665 CCCTCACAGGGTGTGTGATGGGG - Intergenic
986662771 5:10074176-10074198 TCCAGGCAGGATGAGTGATGGGG - Intergenic
987401921 5:17486702-17486724 CCCTGGACGTGTGTGAGATGTGG + Intergenic
987403168 5:17498700-17498722 CCCTGGACGTGTGTGAGATGTGG + Intergenic
987405351 5:17518836-17518858 CCCTGGACGTGTGTGAGATGTGG + Intergenic
987405796 5:17522270-17522292 CCCTGGACGTGTGTGAGATGTGG + Intergenic
987406243 5:17525704-17525726 CCCTGGACGTGTGTGAGATGTGG + Intergenic
987406689 5:17529138-17529160 CCCTGGACGTGTGTGAGATGTGG + Intergenic
987407456 5:17585267-17585289 CCCTGGACGTGTGTGAGATGTGG - Intergenic
987408602 5:17593903-17593925 CCCTGGACGTGTGTGAGATGTGG - Intergenic
987409058 5:17597337-17597359 CCCTGGACGTGTGTGAGATGTGG - Intergenic
987411512 5:17619767-17619789 CCCTGGCCATGTGTGAGATGTGG - Intergenic
987413933 5:17643062-17643084 CCCTGGACGTGTGTGAGATGTGG - Intergenic
987416629 5:17669387-17669409 CCCTGGGTGTGTGTGAGATGGGG - Intergenic
987524405 5:19029726-19029748 TCCTTGCAGGGTGTGCCATGCGG + Intergenic
988139563 5:27218304-27218326 CCCTCGCAGGCCGTGTAATGGGG - Intergenic
988566591 5:32324004-32324026 CCCTCGAAGGGCGTGCGATGGGG - Intergenic
988960813 5:36369605-36369627 CCTTGGAAGGGTGCTTGATGAGG - Intergenic
989204440 5:38797377-38797399 CCCTTACAGGGTGTGCGATGGGG + Intergenic
990560572 5:56979710-56979732 CCCTCGCAGCGCATGTGATGGGG + Intergenic
990585482 5:57207374-57207396 CCTTTGCAGGGCATGTGATGGGG + Intronic
990698117 5:58445610-58445632 CCCTTGCAGGGTGTGCGGTGGGG + Intergenic
991196430 5:63939469-63939491 CCCTCGCAGGGCATGTGATGGGG - Intergenic
992093669 5:73340749-73340771 CCCTTGCAGGGCGTGTGATGGGG - Intergenic
992773389 5:80069503-80069525 CCCTGGGATGATGGGTGATGGGG + Intronic
994301856 5:98157123-98157145 CCCTAGCAGGGAATGTGATGCGG + Intergenic
994424414 5:99565949-99565971 CATTAGCAGGGTGTGTAATGAGG - Intergenic
994661704 5:102661601-102661623 CCCTCACAGAGTGTGCGATGGGG - Intergenic
994790148 5:104214379-104214401 CCCTTGCAGGGTTTGTTAAGAGG - Intergenic
994871147 5:105351518-105351540 CCCTTGCAGGATGCATGATGGGG + Intergenic
994884934 5:105548723-105548745 CCCTCGCAGGGTGTGAGATTGGG + Intergenic
994886184 5:105564460-105564482 CCCTTGCAGGGCGTGCGATGGGG - Intergenic
994929569 5:106163862-106163884 CCCTCACAGGGCGTGCGATGGGG - Intergenic
995332857 5:110965024-110965046 CCATGGCAGGTTCTGTCATGTGG - Intergenic
995538031 5:113156981-113157003 CCCTGGGAGAGTCTGTCATGAGG - Intronic
996565836 5:124879354-124879376 CCTTTGCAGGGTGAGTGATGGGG + Intergenic
998001220 5:138627795-138627817 CACTGGCAGGATGAGTGATGGGG - Intronic
999007234 5:147996456-147996478 CCTTCACAGGGTGTGTGATGGGG + Intergenic
999750884 5:154627575-154627597 CAGAGGCAGGGTGTGTGTTGGGG - Intergenic
1000132932 5:158317608-158317630 CCATGGGAGGGAGTGTGATGGGG - Intergenic
1000470134 5:161630711-161630733 CCCACGCAGGGTGTGTGACAGGG + Intronic
1001537577 5:172508912-172508934 CTCTGGGAGAGTGTGTAATGTGG - Intergenic
1001679561 5:173546112-173546134 CCAGGGCAGGGTGTGAGCTGTGG + Intergenic
1001733780 5:173981695-173981717 CCCTGGCAACCTGTATGATGCGG - Intronic
1002843404 6:924899-924921 CCCTCGCAGGGCGTGCGCTGGGG - Intergenic
1003533325 6:6955617-6955639 CCCTCGCAGGATGTGTGACAGGG + Intergenic
1004018960 6:11759058-11759080 ACCTGGCAGGGAGTGAGATGGGG + Intronic
1005379424 6:25218257-25218279 CCCTGGGAGGGAGTGGGGTGGGG - Intergenic
1005660864 6:27998346-27998368 CCCTCACAGGGTGTGTGACAGGG + Intergenic
1005794701 6:29347610-29347632 CCCTCGCAGGGCATGCGATGGGG + Intergenic
1006244347 6:32717365-32717387 CCCTTGCAGGGAGTGCGATGTGG + Intergenic
1006458178 6:34143778-34143800 GAATGGCAGGGTGTGGGATGGGG + Intronic
1007470741 6:42088644-42088666 CCCTGGCAGGGCATGGGCTGAGG - Intergenic
1008727608 6:54441354-54441376 CCCTTGCAGGGTGTGTGATGAGG + Intergenic
1008730816 6:54480840-54480862 TGCTTGCAGGGTATGTGATGGGG + Intergenic
1009543826 6:65000227-65000249 CCCTTGCAGGGTGTGTGACAGGG - Intronic
1011326255 6:86152189-86152211 CCCTCCCAGGGCATGTGATGGGG + Intergenic
1011639646 6:89406940-89406962 CCCTTGCAGGGTGTGTGATGGGG - Intronic
1011801658 6:91022520-91022542 CCCTCGCAGGGCGTGTGACAAGG - Intergenic
1011873455 6:91926517-91926539 CCCTAGCAGGGCGTGCGATGGGG + Intergenic
1012330537 6:97979574-97979596 CCCTCGCAGGGCGTGCGATGTGG - Intergenic
1012440259 6:99255543-99255565 CCCTCGCAGGGCATGTGATGGGG - Intergenic
1012512739 6:100023036-100023058 CCCTGGGAGGCTGAGTGAAGAGG + Intergenic
1013113077 6:107079616-107079638 CCCTTGCAGGGCATGCGATGGGG - Intronic
1013561372 6:111308956-111308978 CCCTTGCAGGGTGTGCGAGAGGG + Intronic
1014447582 6:121546714-121546736 CTCTGGCACGGTGTGCGAAGGGG + Intergenic
1014718035 6:124888149-124888171 CCCTCGCAGGGTATGTGATGGGG - Intergenic
1015462085 6:133502974-133502996 CTCTCACAGAGTGTGTGATGTGG + Intronic
1016532723 6:145076160-145076182 CCCTCACAGGATGTGTGATGGGG + Intergenic
1016637517 6:146310951-146310973 CCCTGGGATGGTTTGTTATGCGG + Intronic
1017339246 6:153301766-153301788 CCCTGGCAGGGCGTGCGATGGGG + Intergenic
1017619061 6:156276164-156276186 CCCTGGCAGGGTGGCTGCAGAGG - Intergenic
1017650064 6:156572521-156572543 CCCTGGCATGGTGTGAGCAGTGG - Intergenic
1017980198 6:159394545-159394567 CCCTCACAGGGCATGTGATGGGG - Intergenic
1018302999 6:162423524-162423546 CCCTGTCATTGTGTGTGATAAGG - Intronic
1018620470 6:165725490-165725512 CCCTTGCAGGGTGTATGATGGGG - Intronic
1018725746 6:166612252-166612274 CCTTGACGAGGTGTGTGATGTGG + Intronic
1018794363 6:167174507-167174529 CCCTCCCAGGGTGTGCGAAGGGG + Intronic
1018821956 6:167380560-167380582 CCCTCCCAGGGTGTGCGAAGGGG - Intronic
1019256765 7:57349-57371 CCATGGCAGGCTGGGTGCTGGGG + Intergenic
1019279818 7:193907-193929 GCCGGGCAGGGAGTGTGGTGCGG + Intronic
1020545484 7:9523977-9523999 GCCTGTCAGGGGGTGGGATGGGG - Intergenic
1022529269 7:31057083-31057105 ACCCGGCAGGGGGTGTGGTGTGG - Intronic
1022538807 7:31116416-31116438 ACCAGGCATGGTGTGTGATAAGG + Intergenic
1022877102 7:34545206-34545228 CCCTCGCAGGGTGTGAGATGGGG - Intergenic
1024264602 7:47597093-47597115 CCCTTGCAGGGAGTGTGATGGGG - Intergenic
1024268070 7:47621739-47621761 CCCTCGCAGGGTGTGTGATGGGG + Intergenic
1024841305 7:53590720-53590742 CCTTCACAGGGCGTGTGATGGGG + Intergenic
1025820251 7:64955907-64955929 CCCTCACAAAGTGTGTGATGCGG - Intergenic
1026111009 7:67458940-67458962 CCCCGGTAGGGCCTGTGATGGGG + Intergenic
1026313981 7:69212025-69212047 CCCTCACAGGGTGTGCAATGTGG - Intergenic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1027173363 7:75888268-75888290 CCCTGGCACGGTGTATTCTGGGG + Exonic
1027218274 7:76198154-76198176 CCATGGCTGGGTGTGTGGAGAGG - Intergenic
1027543015 7:79492163-79492185 CTCTGGCATGGTGTCTGATATGG + Intergenic
1027932327 7:84553136-84553158 CCCTCGCAGGGCATGTGATGGGG - Intergenic
1028892027 7:95999115-95999137 CACTGCCAGAGTGTGTTATGGGG - Intronic
1029600605 7:101561152-101561174 CCCAGGCAGGGAGTGTGAGTAGG + Intergenic
1029730330 7:102434222-102434244 CCCAGGCAGGGGGTGGGGTGGGG - Intronic
1030101850 7:105953555-105953577 CCATTGCAGGGCGTGCGATGAGG - Intronic
1030769572 7:113457227-113457249 CCCTTGCAGGGTGTGCGATGGGG - Intergenic
1031179274 7:118394146-118394168 CCCTCGCAGGATGTGCGATGGGG + Intergenic
1031232363 7:119124018-119124040 CCTTTTCAGGGTGTGAGATGGGG - Intergenic
1032316233 7:130841617-130841639 CCCTCACAGGGTGTGTGATGGGG + Intergenic
1032921223 7:136550455-136550477 TCATGGCATGGTGTGAGATGGGG - Intergenic
1033841949 7:145386101-145386123 CCTGAGCAGTGTGTGTGATGTGG + Intergenic
1034228588 7:149501534-149501556 GCCTCTCAGGGTGTGAGATGGGG + Intergenic
1034967969 7:155403256-155403278 GCCTGGCATGGTGGGTGAGGAGG + Intergenic
1035339910 7:158153567-158153589 CCCTCACAGGGCGTGCGATGGGG - Intronic
1036101960 8:5796377-5796399 CCCTCACAGGGTGTGTGACAGGG - Intergenic
1037562317 8:20086061-20086083 CACTGGGAGGGTCTGGGATGGGG + Intergenic
1039389944 8:37171512-37171534 TCCCCGCAGGGCGTGTGATGGGG + Intergenic
1039596658 8:38796404-38796426 CCAGAGCAGGGTGTGTGATGGGG + Intronic
1039865623 8:41499134-41499156 CCCTCGCAGGGCGTGTGATGGGG + Intronic
1040652643 8:49465818-49465840 CCCTCGCAGGGTGTGCGACCAGG - Intergenic
1040782174 8:51122168-51122190 CCCTCGCAGGGCATGCGATGGGG - Intergenic
1040787452 8:51181977-51181999 GCCTCACAGGGCGTGTGATGAGG - Intergenic
1041431919 8:57791675-57791697 ACTTGGAAGGGTGTGTGATGGGG + Intergenic
1041586309 8:59523847-59523869 CCCTCACAGGGTATGTGACGGGG - Intergenic
1041934773 8:63322793-63322815 CCCTCACAGGGAATGTGATGGGG - Intergenic
1042499228 8:69490575-69490597 CCTTGGCAGTGTGTGGGAAGGGG - Intronic
1042598256 8:70472105-70472127 CCCTCGCAGGGTGTGTGATGAGG - Intergenic
1043513274 8:80970845-80970867 GGCTGGCAGGGTCTGTGATATGG + Exonic
1043605224 8:81991365-81991387 CCCTTGCAGGGTGTGCGATGGGG + Intergenic
1045358622 8:101411856-101411878 CCCAGGGAGGGTGTGGGGTGGGG - Intergenic
1045938444 8:107710625-107710647 CCCTCGCAGTGTGTGTGATGAGG + Intergenic
1046142767 8:110116251-110116273 CCCTCACAGGAAGTGTGATGGGG - Intergenic
1046229452 8:111334784-111334806 CCCTCGCAGGGAGTTCGATGGGG + Intergenic
1046250409 8:111623876-111623898 CCCTCGCAGGGCATGCGATGGGG + Intergenic
1046590274 8:116198136-116198158 CCCTTGCAGGGTGTGCGATGGGG + Intergenic
1047883207 8:129218945-129218967 CCCTCGCAAGGCATGTGATGAGG - Intergenic
1048082914 8:131148521-131148543 CCCTCACAGGGCATGTGATGGGG + Intergenic
1048491909 8:134901939-134901961 CCCTGGGAGGCTGGGTGTTGTGG - Intergenic
1048623324 8:136158784-136158806 CCCTCACAGGATGTGTGATAGGG + Intergenic
1048731051 8:137441607-137441629 CCCTCGCAGGACATGTGATGGGG + Intergenic
1048769245 8:137877875-137877897 GCCTGTCAGGGTGTGGGGTGGGG - Intergenic
1048770884 8:137893458-137893480 TCCTGGCTGGGTGGGTGAGGAGG + Intergenic
1048992233 8:139767223-139767245 CCCTGTCTAGCTGTGTGATGTGG - Intronic
1049063435 8:140294331-140294353 CCCGGGCAGGCTGGGTGAGGCGG - Intronic
1049414974 8:142490996-142491018 CCCTGGGAGGGGGTGGGAGGCGG - Intronic
1049446685 8:142634564-142634586 CCCTGGCAGGGGCTGGGGTGGGG - Intergenic
1049757334 8:144316502-144316524 CTCTGGCAGCGGGTGTGAGGTGG + Exonic
1049872608 8:144992727-144992749 CCCTGGCTGGCTGTGTGATCTGG + Intergenic
1049885133 9:21691-21713 CCCTGGCAGGGTGTGGGGCAAGG - Intergenic
1050944516 9:11500493-11500515 CCCTAGCAGGCTGTGCAATGGGG + Intergenic
1051103529 9:13550613-13550635 CCCTTGCAGGGTGTGACAGGGGG + Intergenic
1051112222 9:13651797-13651819 CCCTGGTTAAGTGTGTGATGTGG + Intergenic
1051144130 9:14008147-14008169 CGCTTGCAGGACGTGTGATGGGG - Intergenic
1052370189 9:27655494-27655516 CCTTCACAGGGTGTGCGATGGGG - Intergenic
1053032814 9:34797104-34797126 CCCTCTCAGGGCGTGCGATGGGG + Intergenic
1053147833 9:35723920-35723942 CCCTGACAGGGTATAGGATGTGG + Intronic
1053525567 9:38826591-38826613 CCCCAGCAGGGCGTGTGATGGGG - Intergenic
1054197796 9:62051018-62051040 CCCCAGCAGGGCGTGTGATGGGG - Intergenic
1054640558 9:67537354-67537376 CCCCAGCAGGGCGTGTGATGGGG + Intergenic
1056327420 9:85491276-85491298 CCCTCGCAGGGCATGTGATGGGG - Intergenic
1056573226 9:87834445-87834467 CCCTCGCAGGGCATGTGATGGGG + Intergenic
1056702925 9:88925760-88925782 CCCAGGAAGGGTATGAGATGGGG - Intergenic
1057003477 9:91534351-91534373 CCCTGGAAGTGTGTGTGTTTAGG - Intergenic
1057276628 9:93679627-93679649 CCCTGGCAGTGAGGGTGGTGGGG + Intergenic
1058236540 9:102497752-102497774 CCCTTGCCGGGCATGTGATGGGG + Intergenic
1058311870 9:103514492-103514514 CCCTTGCAGGGCATGCGATGAGG + Intergenic
1058400593 9:104614195-104614217 CCCTGGCAGAGCATGTGATGGGG + Intergenic
1058584413 9:106491890-106491912 CCCTCACAGGGTGTGCAATGGGG + Intergenic
1060201983 9:121656620-121656642 CCCTCTCAGGTTGTGTAATGAGG + Intronic
1060309724 9:122448490-122448512 CCCGTGAAGGGTCTGTGATGAGG - Intergenic
1060561513 9:124548903-124548925 CCATGGCAGGAAGTGGGATGGGG - Intronic
1061566982 9:131447331-131447353 GCGTGGCAGGGTGTGTGGGGTGG + Intronic
1061899218 9:133664455-133664477 CCGAGCCAGGGTGTGGGATGGGG - Intronic
1062745924 9:138211992-138212014 CCCTGGCAGGGAGGGTGCAGGGG + Intergenic
1185729427 X:2449342-2449364 CCCTGCCATGGTGTGTGTTAGGG - Intronic
1185730822 X:2460269-2460291 CCCTGCCATGGTGTGTGTTAGGG - Intronic
1185733766 X:2481816-2481838 CCCTGCCATGGTGTGTGTTAGGG - Intronic
1185942814 X:4340479-4340501 CCCTCACAGGGTGTGCAATGGGG + Intergenic
1186439107 X:9569976-9569998 TCCTGGCATGGGGTGGGATGGGG + Intronic
1187138584 X:16571505-16571527 CCCTTGCAGGGTGTGCCATGGGG - Intergenic
1188437625 X:30180055-30180077 CCCTCGCAGGGTTTGTGACAGGG - Intergenic
1189152942 X:38726307-38726329 CCCTGGCAGGGAGTGGGGAGCGG - Intergenic
1189642207 X:43085430-43085452 CCCTTGCAAGGCCTGTGATGGGG + Intergenic
1189833293 X:44996942-44996964 CCCTCGCAGGGCATGTGATGGGG + Intronic
1189959011 X:46307200-46307222 CCCTCACAGGGCATGTGATGGGG + Intergenic
1190619521 X:52271363-52271385 CCCTCACAGGGCATGTGATGTGG + Intergenic
1190795542 X:53737797-53737819 CCCTGGCTGTGTGTTTGATGTGG - Intergenic
1190918323 X:54826427-54826449 TCCTGGCAGGGTGTCAGAGGGGG - Intergenic
1191146568 X:57172316-57172338 CCCTCACAGGGTGTGAGACGTGG + Intergenic
1192225603 X:69225649-69225671 CCGTGGTAGTGGGTGTGATGTGG - Intergenic
1192712882 X:73610035-73610057 GCTTGGAAGGGTGTGTGATTGGG - Intronic
1193836273 X:86348810-86348832 CCCTCTCAGGGCTTGTGATGGGG + Intronic
1193898279 X:87141353-87141375 CCCTCGCAGGGTGTGCGATGGGG - Intergenic
1194068215 X:89288045-89288067 CTCTTGCAGGGTGTGAAATGGGG + Intergenic
1194163316 X:90483073-90483095 CCCTCGCAGGATGTGTGACAGGG + Intergenic
1194535619 X:95103198-95103220 CCCTTGCAGGGTGAGCAATGGGG + Intergenic
1195367241 X:104138372-104138394 CCCTTGCAGGGTGTGCAATGGGG + Intronic
1195671640 X:107474878-107474900 CCCTGGCAGGGCTGGTGATGGGG + Intergenic
1196072360 X:111539694-111539716 CCCTCGCAGGGCATGTGATGGGG - Intergenic
1197433205 X:126391985-126392007 GCCTGTCAGGGTGTGGGGTGGGG + Intergenic
1197555410 X:127946953-127946975 TCCTGGAAGTGGGTGTGATGTGG + Intergenic
1200509585 Y:4060798-4060820 CCCTTGCAGGATGTGTGACACGG + Intergenic
1200722357 Y:6622215-6622237 CTCTTGCAGGGTGTGAAATGGGG + Intergenic
1200839443 Y:7765611-7765633 CCCTGAGGGAGTGTGTGATGGGG - Intergenic
1201170778 Y:11260966-11260988 CCCTGGGAGGGTGGGGAATGGGG + Intergenic
1202019996 Y:20454148-20454170 CCCTTACAGGGCATGTGATGGGG - Intergenic