ID: 1094368388

View in Genome Browser
Species Human (GRCh38)
Location 12:29708083-29708105
Sequence CTGACATATCCCACAGTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094368388_1094368393 12 Left 1094368388 12:29708083-29708105 CCCAGTACTGTGGGATATGTCAG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1094368393 12:29708118-29708140 GACAAGCCTTGACCTCCAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094368388 Original CRISPR CTGACATATCCCACAGTACT GGG (reversed) Intronic