ID: 1094369691

View in Genome Browser
Species Human (GRCh38)
Location 12:29724568-29724590
Sequence TTACACAGCTGGGAAATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 14, 3: 46, 4: 381}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094369688_1094369691 4 Left 1094369688 12:29724541-29724563 CCAACTTACACAGCATTACATAG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1094369691 12:29724568-29724590 TTACACAGCTGGGAAATGACTGG 0: 1
1: 0
2: 14
3: 46
4: 381
1094369687_1094369691 11 Left 1094369687 12:29724534-29724556 CCATTATCCAACTTACACAGCAT 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1094369691 12:29724568-29724590 TTACACAGCTGGGAAATGACTGG 0: 1
1: 0
2: 14
3: 46
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094369691 Original CRISPR TTACACAGCTGGGAAATGAC TGG Intronic
900772474 1:4556166-4556188 TCACACAGCTGGGAAGTGATGGG + Intergenic
900860361 1:5224695-5224717 TTCCACAGCTGGGAAGGGGCAGG + Intergenic
902248277 1:15136335-15136357 CCACACAGCTGGTAAATGACAGG - Intergenic
902547555 1:17199481-17199503 TTACCCAGCTGGAAAGTGAAGGG + Intergenic
902713807 1:18258668-18258690 TTACACAGCTGGAAAACGCAAGG - Intronic
903164780 1:21512540-21512562 CTACACAGCAGGGAAAACACTGG + Intronic
903602348 1:24551927-24551949 TTTCTCATCTGTGAAATGACGGG - Intergenic
904017996 1:27438545-27438567 TTACACAACTGAGAAAGGCCAGG + Intronic
904089765 1:27936581-27936603 TCTCCCAGCTGGGAAATGGCAGG + Intronic
904337850 1:29809801-29809823 TCACGCAGCAGGCAAATGACTGG + Intergenic
904813136 1:33176747-33176769 TCACGCAGCTGGTAAATGGCAGG - Intronic
904891830 1:33784921-33784943 TTACACAGCTGGGACCACACTGG + Intronic
904950925 1:34238109-34238131 TTTCACAGCTGGTAAATGGTAGG - Intergenic
905102352 1:35535487-35535509 TGACACAGTTAGGAAGTGACTGG - Intronic
905297628 1:36964151-36964173 TTACACAGCTGGGCGAGGTCTGG + Intronic
905480832 1:38260878-38260900 TAGCACAGTTGGGAAATGGCAGG - Intergenic
906265492 1:44425610-44425632 TCACACGGCTAGTAAATGACAGG - Intronic
906286171 1:44589231-44589253 TCACACAGCTGGGAAATGGAGGG - Intronic
906651898 1:47518767-47518789 TTACACAGTTGGAAAGTGGCAGG - Intergenic
906693133 1:47806043-47806065 CCACACAGCTGGTAAAAGACAGG + Intronic
906797765 1:48711367-48711389 TCACACAGATGGGAACTGACAGG - Intronic
907072694 1:51551304-51551326 CTACAGAGCCAGGAAATGACAGG - Intergenic
907297683 1:53465782-53465804 TTACACAGCTGGGCAAGTGCTGG - Intronic
907354411 1:53860748-53860770 TTCTTCAGCTGGGAAATGAAAGG + Intronic
907518146 1:55006306-55006328 TCACACAGCCGGGAAGTGACTGG - Intronic
907578140 1:55547147-55547169 TTCCACAGCTTGGAAGTTACAGG - Intergenic
908597115 1:65700128-65700150 TCACACAGCTAGTAAATGGCTGG + Intergenic
910451315 1:87348846-87348868 TTACACAGCTGTAACATGTCAGG - Exonic
910934661 1:92477951-92477973 TCACACTGCTAGCAAATGACAGG - Intronic
911469348 1:98297861-98297883 GTACACAGGTTGGAAATCACAGG + Intergenic
911779286 1:101855350-101855372 TCACACAGCTAATAAATGACAGG + Intronic
912587188 1:110777917-110777939 TTACGCAGCTGGGTGGTGACAGG - Intergenic
913233237 1:116759465-116759487 TCACACAGCTAGGAAGTGATGGG + Intronic
913470252 1:119179409-119179431 TTACACAGCGTGGGACTGACAGG + Intergenic
913532120 1:119740880-119740902 TCACACAGCAGGGAAGAGACAGG - Intronic
914355648 1:146882056-146882078 TCACACAGCTAGGAAGTGGCTGG - Intergenic
914917099 1:151825587-151825609 TTACACAGCTGGTATCTGATGGG - Intronic
915088251 1:153403609-153403631 TAAAACAGCTGGGAAAGGGCAGG - Intergenic
915476952 1:156158657-156158679 TCTCACATCTGGGAAATGAGGGG - Intronic
916281689 1:163058766-163058788 TTACATAGCTAAGAAATAACAGG - Intergenic
916740488 1:167643050-167643072 TTACAGAGCACGGAACTGACCGG - Intronic
916849955 1:168693698-168693720 TCATAAAGCTGGGAAGTGACAGG + Intergenic
918189885 1:182163936-182163958 CTCCCCAGCTGGGAAATGAAGGG - Intergenic
919675169 1:200374970-200374992 TTACACAGCTGGTTTGTGACAGG + Intergenic
919766145 1:201128407-201128429 TCACACAGCTAGGAAAAGTCAGG + Intergenic
920006054 1:202834662-202834684 TCACTCAGCTAGTAAATGACAGG - Intergenic
920711153 1:208296263-208296285 GTACACAGCTATGAAATGAAGGG - Intergenic
921192025 1:212718801-212718823 GCACACAGCTGGGAAACCACTGG + Intergenic
921707249 1:218337222-218337244 TTACATAGATGAGAAATGAATGG - Exonic
921714877 1:218407716-218407738 TCACACAGGTGGGAAATGGCAGG + Intronic
922342653 1:224670110-224670132 TCACAGAGCTGGGAACTGGCAGG + Intronic
922991950 1:229921663-229921685 TTCCCCAGCTGAGAAATGACAGG - Intergenic
923611301 1:235496891-235496913 TCAAACAGCTTGGAAATGGCTGG + Intronic
924335727 1:242985309-242985331 TAACACAGTAGGGGAATGACAGG - Intergenic
1063777138 10:9276024-9276046 TCACACAGCAAGTAAATGACAGG - Intergenic
1064029071 10:11871599-11871621 TTACACAGCAGGAAAAGAACCGG + Exonic
1064605993 10:17039388-17039410 TTATACAGGTGGGACATTACAGG - Intronic
1064687797 10:17882248-17882270 TTATACAGCTTGGAAAAGAGAGG + Intronic
1068859586 10:61833788-61833810 TTACACAGCTAGGAAATGATGGG - Intergenic
1070574130 10:77664628-77664650 TGACACAGCTGGGAAATCTGGGG - Intergenic
1070662753 10:78319392-78319414 TCACACAGCTAGTAAATGGCAGG - Intergenic
1070751105 10:78964452-78964474 TCACACAGCTAGGAAATGGCAGG + Intergenic
1070853007 10:79583065-79583087 TCACACAGCCGGGAAGTGGCAGG - Intergenic
1070888073 10:79922240-79922262 TCACACAGCCGGGAAGTGGCAGG + Intergenic
1071860334 10:89665903-89665925 TTGCACAGCTAGGAAGTGAGTGG - Intergenic
1073590367 10:104751643-104751665 TCACTCAGCTGTGAAATGAGAGG + Intronic
1073596514 10:104805745-104805767 TGAGAAGGCTGGGAAATGACAGG - Intronic
1073858568 10:107708255-107708277 TTACAAAGCTGGTAATTGGCAGG + Intergenic
1074285732 10:112096506-112096528 ATACACAGCTAAGTAATGACTGG + Intergenic
1075498343 10:122948145-122948167 TGATATAGCTGGGAAATGAATGG - Intronic
1075520507 10:123141012-123141034 TTACAAAGTCGGGAAATAACTGG + Intergenic
1076196304 10:128520714-128520736 TTGCACAGCTGGGTCATCACTGG + Intergenic
1078439715 11:11354282-11354304 TTGCTCACCTGGGAAATGAAGGG - Intronic
1078443567 11:11387283-11387305 GAAGGCAGCTGGGAAATGACAGG - Intronic
1078724740 11:13919974-13919996 TTACAGAGCTAGGAAATGGCAGG + Intergenic
1078912249 11:15743702-15743724 TTACACAGCTAGCAAGTGGCAGG - Intergenic
1079493971 11:21020014-21020036 TCACATAGCTAGTAAATGACAGG - Intronic
1079548684 11:21667625-21667647 TTACTCATCTGGTAAATGAATGG - Intergenic
1080162700 11:29197308-29197330 GTACACAGCTGGTAAGAGACAGG - Intergenic
1080222959 11:29927719-29927741 TCACCCAGAAGGGAAATGACTGG - Intergenic
1080443436 11:32315771-32315793 TCACACAGCTGGTAACTGGCTGG - Intergenic
1080499213 11:32852738-32852760 TCACATAGTTAGGAAATGACAGG + Intronic
1080749272 11:35138094-35138116 TTGGACAGATGGGAAATGAGTGG + Intergenic
1081096098 11:38937323-38937345 TTACACAGCTGGTAAATGATAGG - Intergenic
1081113792 11:39172302-39172324 TTACACAGCTGGTAAGTAAAGGG + Intergenic
1081428602 11:42951468-42951490 TGACTCAGCTGGGAATTGGCTGG - Intergenic
1081506744 11:43725196-43725218 TAACAAAACTAGGAAATGACTGG - Intronic
1081598312 11:44474541-44474563 TCACAAAGCTGGCAAGTGACAGG + Intergenic
1081797160 11:45828572-45828594 TCACACAGCTAGGAAGTGGCTGG - Intergenic
1082068008 11:47916482-47916504 TCACACAGCTGGGAAGTAGCTGG + Intergenic
1082900977 11:58251755-58251777 CTATACAGGTTGGAAATGACTGG + Intergenic
1084234953 11:67781643-67781665 TTACACAGCTGAGAAAACCCAGG - Intergenic
1084406450 11:68976757-68976779 TTACACAGCTGGGGAAGAAGAGG + Intergenic
1084970272 11:72767774-72767796 CCACACAGCTGGGACATGGCAGG - Intronic
1084973578 11:72784331-72784353 TGACACAGCTAGGAAATCAGAGG - Intronic
1085795278 11:79533610-79533632 TCACACAGCTAGGGAGTGACTGG - Intergenic
1086205855 11:84257570-84257592 TCACACAGCTGGTAAATAGCTGG + Intronic
1086513291 11:87584201-87584223 TTACAGAGCTTGGACATGTCAGG - Intergenic
1087484196 11:98741195-98741217 TTACACTGCTAAGAAATGAATGG + Intergenic
1090272416 11:125397532-125397554 TCACACAGATAGTAAATGACAGG + Intronic
1090409236 11:126496405-126496427 GTACACAGCTGAAAAATGAAAGG + Intronic
1090750243 11:129740477-129740499 TCACACAGCTGGCATATGGCAGG - Intergenic
1091069117 11:132546645-132546667 TCACACAGCTGGGAAATAAATGG - Intronic
1093997665 12:25659462-25659484 TTTCTCAGCTGGGAAATGCTGGG - Intergenic
1094369691 12:29724568-29724590 TTACACAGCTGGGAAATGACTGG + Intronic
1096680308 12:53251614-53251636 CCACACAGCTGGTAAGTGACAGG + Exonic
1098011694 12:66060054-66060076 TTTCACAGCTCGTGAATGACTGG - Intergenic
1098670979 12:73231318-73231340 GTATTCAGCAGGGAAATGACAGG + Intergenic
1100023158 12:90096238-90096260 CTACACAGCTAGGAAAAGGCTGG + Intergenic
1100350806 12:93780469-93780491 TTACACAGTCGGTAAATGATGGG + Intronic
1100550459 12:95642135-95642157 TCACACAACTGGTAAGTGACAGG + Intergenic
1101128201 12:101661188-101661210 TGACAGAGGTGGGAGATGACTGG + Exonic
1101221687 12:102647875-102647897 TTACTCAGCCTGGAAATGATGGG + Intergenic
1101448296 12:104754109-104754131 TTTCCCAGCTTGGAAATAACTGG - Intronic
1101593361 12:106141456-106141478 TTACACAGTTTGTAAATGGCAGG + Intergenic
1102223858 12:111214064-111214086 TTACAAAGCTGAGAAAAGACAGG - Intronic
1102742667 12:115222160-115222182 TCACACAGCTAGTAAATGATAGG + Intergenic
1103213545 12:119184146-119184168 TCACACAGCTTGGAAGTGACTGG - Intronic
1103938925 12:124491430-124491452 TTTCACAGCTAGGACATCACTGG + Intronic
1104082472 12:125442446-125442468 CCACACAGCTAGTAAATGACAGG - Intronic
1104146264 12:126036805-126036827 TTACACAGCAGTGAAATTCCAGG - Intergenic
1107007269 13:35627540-35627562 TTACACAGTTTGGGAATCACTGG - Intronic
1107088458 13:36450409-36450431 TGATACAGATGAGAAATGACGGG - Intergenic
1107892601 13:44927395-44927417 GTACACAGATGGGCAATGGCTGG - Intergenic
1108313073 13:49214881-49214903 TTACACAGCAGGGACACGGCAGG - Intergenic
1109453068 13:62544171-62544193 TTGCTCAACTGGAAAATGACGGG + Intergenic
1110419572 13:75290860-75290882 GTACACAGCTAGTAAATGGCTGG + Intronic
1110770337 13:79335888-79335910 GTACACAGCAGGGAAAAGATGGG + Intronic
1115138804 14:30143683-30143705 TTGCACAGCTGGGAAAACACAGG + Intronic
1115237450 14:31221486-31221508 TTACACATCTGGTAAATGACAGG + Intergenic
1115410139 14:33064887-33064909 TGACTCGGCTGGGAAATGTCTGG + Intronic
1116066234 14:39986650-39986672 TTGCAAAGCTTGCAAATGACAGG - Intergenic
1116191115 14:41667982-41668004 TTGCACAGCTGGGTCAAGACTGG + Intronic
1116865424 14:50027860-50027882 TCACACAGCTGGGGGAGGACTGG + Intergenic
1117343795 14:54813584-54813606 TTATACAGCTGGTAAGTGCCAGG + Intergenic
1117483362 14:56170552-56170574 TTACACAGTTAGGAAATGTCAGG - Intronic
1117728258 14:58695597-58695619 TTACAGTTCTGGGAAATGACTGG + Intergenic
1118066079 14:62191531-62191553 TTACTTAGCAGGGAAATAACTGG + Intergenic
1118500616 14:66358902-66358924 TCTCACAGTTGGAAAATGACAGG - Intergenic
1118755912 14:68843606-68843628 TGACACAGCTGTGACAAGACAGG - Intergenic
1119453394 14:74732432-74732454 CTATACAGCTGGGAAAAGCCAGG - Intronic
1121604493 14:95230636-95230658 ACACAAAGCTGGGAGATGACAGG - Intronic
1121987871 14:98526029-98526051 TTACAGATCTGGAAAATGAGAGG - Intergenic
1122764443 14:104055803-104055825 TTATACACATGTGAAATGACAGG - Intergenic
1123160587 14:106274916-106274938 TTGCTCAGCTGGAAGATGACAGG + Intergenic
1123481626 15:20637957-20637979 TTGCTCAGCTGGAAGATGACAGG + Intergenic
1123636387 15:22362408-22362430 TTGCTCAGCTGGAAGATGACAGG - Intergenic
1125094973 15:35840120-35840142 TAACACACCTGGGAATTAACTGG + Intergenic
1126096160 15:45092255-45092277 TTACACAGATGAGAAAAGGCAGG - Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1128436945 15:67662044-67662066 TTCCACAGTTTGGAAATAACTGG - Intronic
1130726672 15:86446080-86446102 ATACACAGCTGGGAGAAGATAGG + Intronic
1131116144 15:89797189-89797211 CCACACAGCTGGCAAAAGACAGG + Intronic
1131121550 15:89826159-89826181 TCACACAGCTGTGAAAGGTCAGG - Intergenic
1131724951 15:95211542-95211564 TCACAGATCTGGGAAATGAAAGG - Intergenic
1131738361 15:95359006-95359028 TTCCACAGCTTGGAAAGGAATGG - Intergenic
1133526683 16:6612535-6612557 TTTAACATCTGGGAAATGAATGG - Intronic
1133728127 16:8556038-8556060 TCACAGAGCTGGAAAATGCCAGG - Intergenic
1133759658 16:8788283-8788305 TTATACAGCTGGGAATTGGCAGG + Intronic
1134659927 16:15976457-15976479 TCACCCAGCTAGTAAATGACAGG + Intronic
1134844480 16:17428369-17428391 GCACACAGCTGGAAAGTGACAGG - Intronic
1137448408 16:48547657-48547679 TTACTCAGCTGTGAAGTGAAAGG - Intronic
1138381588 16:56606744-56606766 TTACTCATCTGTCAAATGACTGG - Intergenic
1138547147 16:57726732-57726754 TCACACAGCTGGAAAGTGGCAGG + Intronic
1139717918 16:68828567-68828589 TCACACAGCTAGGAAGCGACAGG + Intronic
1139978369 16:70833387-70833409 TCACACAGCTAGGAAGTGGCTGG + Intronic
1140232410 16:73128463-73128485 TCACACAGCTTATAAATGACAGG + Intronic
1140536920 16:75718300-75718322 TTACACAACTAGGAAAACACTGG - Intronic
1140767280 16:78172048-78172070 TCACACAGCTGGGAGATAACGGG + Intronic
1140924041 16:79565926-79565948 TCACACAGCTAGAAACTGACAGG + Intergenic
1141336841 16:83164057-83164079 TTACCCAGCTGGTAACTGATCGG + Intronic
1141608286 16:85167998-85168020 TTTCACAGATGGGGAATGAGAGG + Intergenic
1141848267 16:86626154-86626176 GTATACAGCTGGGTAACGACAGG - Intergenic
1142928381 17:3260786-3260808 TCACGCAGCCAGGAAATGACAGG + Intergenic
1142968690 17:3596817-3596839 TCGCACAGCTGGGAAGTGACAGG + Intronic
1143464970 17:7130711-7130733 TTACTCCCCTGGGGAATGACAGG + Intergenic
1145188909 17:20821462-20821484 TTAAACACCAGGAAAATGACAGG - Intergenic
1145797428 17:27663998-27664020 CTCCACAGCAGGGACATGACAGG - Intergenic
1148105990 17:45119188-45119210 TCACACAGCTGGTAAATTACAGG + Intronic
1148251908 17:46088916-46088938 TTTCACACCTGGTAAATGAGGGG - Intronic
1148617506 17:49012369-49012391 TTACACATCTGCAAAAGGACAGG - Intronic
1148732287 17:49844780-49844802 TCACCCAGCTGGGAAGTGAGAGG + Intronic
1148875619 17:50685139-50685161 TTGCACAGCTGGGAGAAGGCAGG + Intronic
1149181714 17:53946319-53946341 TTACACAGCTAGCAAAAGATGGG + Intergenic
1150179742 17:63104830-63104852 TTACAGAGTCAGGAAATGACAGG - Intronic
1151242842 17:72771597-72771619 TTACACAGCAGGGACAAGACAGG + Intronic
1152030826 17:77841915-77841937 TCACATAGCTGGTAAATGGCAGG + Intergenic
1153229659 18:2923816-2923838 TCCCACAGCTGGGCAAAGACTGG - Exonic
1153416592 18:4852623-4852645 TCACACAGCTGGAAAGTGATAGG - Intergenic
1153577791 18:6539932-6539954 TGACACAGGTGGTAAATGGCCGG + Intronic
1156355691 18:36338530-36338552 TATCACAGCTGTGAAATGATGGG - Intronic
1157422946 18:47561220-47561242 TTGCAGACCTGGGATATGACTGG - Intergenic
1158923034 18:62215371-62215393 TTACCCACCTGGCAAATGAAGGG + Intronic
1159027436 18:63197236-63197258 TCACACAGCTAGGAAGTGGCAGG - Intronic
1160352452 18:78195256-78195278 TCACACAGCTTGGAAGTGATGGG - Intergenic
1161450885 19:4344606-4344628 TTTCACGGCTGGGAAACCACAGG - Intronic
1162141339 19:8587112-8587134 TTTTACAGCTAGGAAATGACTGG + Intronic
1162214889 19:9125971-9125993 TTACACTGCTGGGATATGTCAGG - Intergenic
1162311494 19:9910276-9910298 TCACACAGCTAGTAAATTACAGG + Intronic
1162893399 19:13749994-13750016 TGACACAGGTGGGAAATGCAGGG - Intronic
1163484099 19:17576362-17576384 TTACAGAGCAGGGAAAGGAAGGG + Intronic
1164742430 19:30585768-30585790 TGACACAGCCCTGAAATGACGGG - Intronic
1164752613 19:30667955-30667977 TCACACAGCTGGTAATTGGCAGG + Intronic
1164874602 19:31674953-31674975 TTTCACTGCTGGAAAATCACAGG + Intergenic
1165086224 19:33349679-33349701 TCCCACAGCTGGGAAAAGCCAGG + Intergenic
1166084322 19:40465137-40465159 TCACACAGCTGTTAACTGACAGG - Intronic
1167020095 19:46867470-46867492 TCACAAAGCTAGTAAATGACAGG - Intergenic
1167146649 19:47684727-47684749 TTGCACAGCTGGCAAATGGTAGG + Intronic
1167267260 19:48489765-48489787 TCACACAGCTAAGAAATGGCAGG + Intronic
1167288006 19:48609760-48609782 TTACACAGATGAGAAAAGAGAGG + Intronic
926116933 2:10219307-10219329 TCACACAGCTGGGAAGTGGCAGG + Intergenic
926654350 2:15384193-15384215 TTACAGAGCTAGGAAATTAATGG + Intronic
927441132 2:23118740-23118762 TTACACAACTGGAAAATGGAGGG - Intergenic
929713023 2:44283514-44283536 TTACTCAGCTAATAAATGACAGG + Intronic
929811723 2:45194377-45194399 TCACAGAGCAGGGAAATGAGTGG - Intergenic
930226606 2:48800540-48800562 CAACAAAGCTGGGAAAAGACTGG + Intergenic
931177797 2:59870917-59870939 TTGCACAGCTGGGGTAGGACAGG + Intergenic
931483031 2:62661983-62662005 TTACACAGCTAATAAATGCCAGG + Intergenic
932479928 2:72032967-72032989 CCACACAGCTGGCAAATGGCAGG - Intergenic
933937058 2:87215040-87215062 TTACACAATTGGGAAAAAACAGG - Intergenic
935162980 2:100545171-100545193 TTACACAGCTAGAAAATGAAGGG - Intergenic
935223712 2:101035876-101035898 GTCCTCAGCTGGGAAATCACAGG + Intronic
935376499 2:102404223-102404245 TTATACATGTGGCAAATGACAGG + Intergenic
935688760 2:105711650-105711672 TTACACAGCTGGTAATTGGCAGG + Intergenic
936356083 2:111750784-111750806 TTACACAATTGGGAAAAAACAGG + Intergenic
938201877 2:129378791-129378813 TTCCACAGCTATGAAATGCCAGG - Intergenic
938785959 2:134630126-134630148 TCACACAGCTGGTAAGTGACAGG - Intronic
939632827 2:144545998-144546020 TTACTCATCTGTAAAATGACAGG - Intergenic
940051490 2:149469783-149469805 TCACACAGCTGGTAAGTGACAGG + Intronic
940294093 2:152104695-152104717 TTACATAGATGGCAAATGATGGG + Intergenic
940320206 2:152368740-152368762 TCACTCAGGTGGGAAATGAGAGG + Intronic
940757429 2:157699256-157699278 TCCCACAGCTGGGAAATGTGTGG + Intergenic
942385874 2:175442202-175442224 TTACACAGCTGGGCATAAACGGG + Intergenic
942386135 2:175445106-175445128 TCACACAGCTGGTAAGTGGCAGG - Intergenic
942505920 2:176641644-176641666 TCACACAGCTAGTAAATGACAGG + Intergenic
942801043 2:179875857-179875879 ATACACACCTCAGAAATGACAGG - Intergenic
944650011 2:201820566-201820588 TTACTCAGATAGGAAGTGACAGG + Intronic
944946576 2:204693942-204693964 TTGAACAGCTAGGAAATGCCAGG - Intronic
945694380 2:213084190-213084212 ATATACAGCTGGTAAGTGACAGG - Intronic
946189293 2:217999421-217999443 TCACACAGCTGTCAAGTGACAGG + Intronic
946331622 2:219012570-219012592 TTGCACAGCTGTGAAATGTTTGG + Intronic
946396651 2:219446732-219446754 TGACACAGCTGGGAAATGATTGG - Intronic
946856643 2:223956883-223956905 TTAAACATCCGGAAAATGACTGG - Intergenic
947371934 2:229455906-229455928 TTACACAGCTAGTAAACGGCAGG + Intronic
947502438 2:230681226-230681248 TAACACAGATGAGAAATGACAGG + Intergenic
947593456 2:231397280-231397302 GTACACCGCAGGGAAATGAAAGG + Intronic
948182604 2:235994332-235994354 TTGCACAGCACGAAAATGACAGG - Intronic
948328150 2:237142870-237142892 TCACACAGCTGGTAAGTGGCTGG - Intergenic
1168751290 20:283740-283762 TCACACAGCCAGGAAATGGCAGG - Intronic
1170032537 20:11958039-11958061 CTGCTCAGCTGGGAAATGGCTGG + Intergenic
1172319030 20:33981969-33981991 GTTCACAGCTGGGACAAGACTGG - Intergenic
1172450335 20:35018178-35018200 TCACACAGCTGGGAAGAGAGGGG + Intronic
1172840445 20:37900077-37900099 TTACACAGCTACCAAATGGCAGG + Intergenic
1172870500 20:38132603-38132625 TCACACAGCGGGGGAATGGCTGG + Intronic
1173200335 20:40950041-40950063 TCACACAGCTGGTAAATAGCTGG - Intergenic
1174199965 20:48800215-48800237 TCACACCGCTGGGAAGTGGCAGG + Intronic
1174819988 20:53718283-53718305 TTACACACTTGAGAAATGACTGG + Intergenic
1175058558 20:56220428-56220450 ACACACAGCTAGGAAATGTCTGG + Intergenic
1175348675 20:58302159-58302181 TAACACAGCTAGTAAGTGACGGG - Intergenic
1175538433 20:59732278-59732300 TCACACAGCTGGTAAATGGCAGG - Intronic
1177774257 21:25550454-25550476 TTACACAGCGGGAATATAACTGG - Intergenic
1178125724 21:29513644-29513666 TTACAAATCTGGGAATTGACTGG - Intronic
1178430765 21:32516928-32516950 TCACACAGCTGGGAAGTGCTGGG + Intergenic
1178515916 21:33247012-33247034 TTACAGAGCTAGGAAGTGGCAGG - Intronic
1178723837 21:35034129-35034151 TCACACAGCTGGGAAATGGCAGG - Intronic
1179425536 21:41275327-41275349 ATCCACAGCTGTGAAATGAGCGG - Intronic
1182030518 22:27155828-27155850 TAACACAGAGGGGAAAGGACTGG + Intergenic
1182779379 22:32855498-32855520 CCACACAGTTGGGAAATGGCAGG - Intronic
1182875931 22:33690982-33691004 TTCCAGAGCTAGGAAATAACTGG - Intronic
1183123651 22:35753232-35753254 TTCCACAGATGGGAAATGTATGG + Intronic
1183703548 22:39463291-39463313 GTCCACAGCTGGGAAGTGGCAGG + Intronic
1183856002 22:40635831-40635853 TTACACAGCTAGCAAGTGGCAGG + Intronic
1183913470 22:41096990-41097012 TTACAGAGCTGGAAAATAAATGG - Intronic
1184343537 22:43899345-43899367 TAACCCAGCTGGGAACTGGCAGG + Intergenic
1184581590 22:45421694-45421716 TAACAGAGCTCGGAAATGTCTGG + Intronic
949460922 3:4292898-4292920 TTACAGAGCCTGGAAATTACAGG - Intronic
950165369 3:10793218-10793240 TCACACAGCTGGGAAGTGCAGGG + Intergenic
950555924 3:13696005-13696027 TCAGACAGCTGGGAAAGGAGGGG + Intergenic
950718502 3:14866194-14866216 TTTCAGAGATGGGGAATGACTGG - Intronic
950906670 3:16545060-16545082 TTGCACAGCTTGGAAATGTGAGG - Intergenic
951429974 3:22595372-22595394 ATACACAGAGGGGAAAAGACAGG + Intergenic
954755794 3:52839024-52839046 TTCCACAGCAGGGAAACGGCTGG + Exonic
954798599 3:53174323-53174345 TTAGGCAGCTGGGAAAGGCCTGG + Intronic
956075832 3:65504466-65504488 TTACACAGCTGGTAAGTGTCAGG + Intronic
956499601 3:69868326-69868348 TGATACAGCTAAGAAATGACAGG + Intronic
956762752 3:72458414-72458436 TCGCACATCTGGGAAGTGACTGG + Intergenic
956776719 3:72571227-72571249 TTTCTCAGGTGGGAAATGAAGGG + Intergenic
958709562 3:97700899-97700921 TGACACAGCAGGGAAAAGAATGG + Intronic
958806222 3:98813888-98813910 TTGCACAGCTAGTCAATGACAGG + Intronic
960931528 3:122855789-122855811 TCACACAGTTAGTAAATGACAGG + Intronic
962553587 3:136523227-136523249 TTAAAAAGCCGGGAAATGACAGG - Intronic
964194791 3:154050216-154050238 TTACACAACTGTGTCATGACTGG - Intergenic
964434631 3:156638631-156638653 TTACACAGAAGGAAAAAGACAGG - Intergenic
964597499 3:158452474-158452496 TTACACATATGTGAAATGATAGG + Intronic
964653979 3:159045667-159045689 AAACACAGCTTGGAAATGACTGG + Intronic
965785516 3:172330862-172330884 TTACAGAGATGGGAAAGAACAGG - Intronic
967200416 3:187067852-187067874 TTACCCATCTGGAAAATGATGGG + Intronic
968954657 4:3712088-3712110 TCCCTGAGCTGGGAAATGACGGG + Intergenic
969845218 4:9915113-9915135 CTACACAGCTGGGAAGTCAGAGG + Intronic
970439348 4:16066880-16066902 ATGCACAGCTGGGAAATATCTGG - Intronic
972287915 4:37666236-37666258 TCACTCATCTGGGAAATGGCTGG + Intronic
972422519 4:38902450-38902472 TTACACAGCTCATAAATGATGGG + Intronic
972697543 4:41462812-41462834 TAACACAGCTGGCAAAAGGCAGG + Intronic
972982733 4:44725920-44725942 TTACACAGCTAGTTAATGGCGGG + Intronic
974438381 4:61885756-61885778 TTACATAGCTGGTAATTGATAGG - Intronic
975238105 4:72024802-72024824 TCACACAGCTAGTAAGTGACAGG - Intergenic
977249026 4:94668003-94668025 TTAAACATTTGGGAAATGAGGGG - Exonic
977875091 4:102140187-102140209 TTTGACAGCTAGCAAATGACAGG + Intergenic
978642018 4:110881986-110882008 TGACACAGCTGGGAGACCACAGG - Intergenic
978924566 4:114227239-114227261 TAGGACAGCTGGGAAATGTCAGG - Intergenic
979526423 4:121722178-121722200 TTACACAGCTGGTAAGTGACAGG - Intergenic
980202587 4:129675618-129675640 ATGCCCAGCTGGGAAATGACTGG + Intergenic
981414560 4:144476710-144476732 TTACACAGCAGAGAAATTATTGG + Intergenic
986483122 5:8209484-8209506 TTACACTGCAGTTAAATGACTGG - Intergenic
988619204 5:32805181-32805203 TCACACAGCTAGGAAATGACAGG + Intergenic
988704907 5:33715954-33715976 TTACAGAGCTGTAAAATGCCTGG - Intronic
989150771 5:38297801-38297823 TTTCAGAGCTGAGAAATTACTGG - Intronic
989665982 5:43854348-43854370 TCACCCAGCTGGGAAGTGGCAGG + Intergenic
990481183 5:56212693-56212715 TTGCACAGCTATTAAATGACAGG + Intronic
990495495 5:56343682-56343704 TGACAAAGCTAGGTAATGACTGG - Intergenic
991170690 5:63621896-63621918 TTACATACCTGGAAAATGCCAGG - Intergenic
992640561 5:78765319-78765341 TTACAGCGCTGGGAAATCAGTGG + Intronic
994946006 5:106392650-106392672 TTCCACAGCTAGCAAATGCCAGG + Intergenic
995128861 5:108608828-108608850 TTTCAAAACTGGGAAATGAATGG - Intergenic
996710521 5:126538731-126538753 TCACACAGCTGATAAATGATGGG - Intergenic
996804508 5:127439748-127439770 TCACACAGCTGGCAACTGGCAGG - Intronic
998832448 5:146174680-146174702 TTACATCACTGGGAATTGACTGG - Intronic
999217880 5:149950793-149950815 TTACACAGTTAGCAAATAACAGG - Intergenic
999420815 5:151440804-151440826 TCACCCAGCTGGGAAATAAGGGG + Intronic
999448285 5:151659003-151659025 TTCCCCATCTGGGAAATGAGAGG + Intergenic
999889950 5:155966606-155966628 TCACACAGCTGGTAAAAGAAAGG - Intronic
1000305012 5:159987043-159987065 TTAACCACCTGGGAAGTGACGGG - Intergenic
1000926300 5:167198701-167198723 TGACACAGCTGGGACCGGACAGG - Intergenic
1001260553 5:170224939-170224961 TTACTCAGCTGGGAAATGGCTGG - Intergenic
1001541073 5:172539854-172539876 TCACACAGCTGGGAAATGGAAGG + Intergenic
1001699481 5:173696435-173696457 TTGCACAGCTAGGAAATGGCAGG + Intergenic
1001818206 5:174689101-174689123 TCTCACAGCTGGCAAATGAAAGG + Intergenic
1001901653 5:175435545-175435567 TCACACAGCTGGTAAATGATGGG - Intergenic
1003673128 6:8178464-8178486 TGATACAGCTAGTAAATGACAGG + Intergenic
1004125111 6:12865682-12865704 TTGCAAAGCTGTAAAATGACAGG + Intronic
1005353203 6:24957400-24957422 TTACATAGCTGGTAAATGGGTGG + Intronic
1005637474 6:27765746-27765768 TTGCACTGCTGGGTAAAGACGGG - Intergenic
1006590263 6:35149958-35149980 TTAACCAGCTGGGAAATCTCAGG + Intergenic
1007423258 6:41732316-41732338 TCACACAGCCTGGAAGTGACAGG - Intronic
1007989637 6:46241770-46241792 TTATACAGCTGGGGAATGTGAGG - Intronic
1008463544 6:51804278-51804300 GGACACAGCTGAGAAATTACTGG - Intronic
1008550221 6:52621758-52621780 TCACACAATTGGGAAAGGACAGG + Intergenic
1008932866 6:56958021-56958043 GTCCACAGCTGAAAAATGACAGG + Intronic
1009452236 6:63815309-63815331 TCACAGAGCTAAGAAATGACAGG + Intronic
1010233874 6:73558949-73558971 TTACAGAGCTGGGAAAGGGAGGG + Intergenic
1010542836 6:77113208-77113230 TAACACAGCTGGGTATTGACAGG + Intergenic
1011160485 6:84383960-84383982 ATACACAACAGGGAAATGATAGG - Intergenic
1011346846 6:86379707-86379729 TTACACAGCTGTGTAATATCTGG - Intergenic
1012650821 6:101750251-101750273 TTACACAGAAGGTAAGTGACAGG + Intronic
1013107110 6:107035022-107035044 TGGCACAGCTAGTAAATGACAGG - Intronic
1013452056 6:110292222-110292244 TCACACATGTGGGATATGACTGG + Intronic
1014175228 6:118324850-118324872 TTACGCAGCTAGCAAATGATGGG + Intergenic
1014310982 6:119801184-119801206 TTTCACAGCTGAGAAAACACAGG - Intergenic
1017881295 6:158564368-158564390 TTTCACAGGTGGGAAAACACAGG - Intronic
1020959128 7:14780140-14780162 TTTGCCAGCTGGGAAATGAGCGG + Intronic
1022180330 7:27912838-27912860 TATGACAGCTGGGAAAAGACTGG + Intronic
1022623779 7:32012869-32012891 TTTTACAGCTGGAAAATGAGAGG - Intronic
1022972122 7:35528062-35528084 TTGCCCAGCTGGGAAGTGGCAGG + Intergenic
1023124485 7:36941900-36941922 TCACACACCTGGGAAGTGGCAGG + Intronic
1023305911 7:38826707-38826729 TCACACAGCTAAGAAGTGACAGG + Intronic
1023940241 7:44764857-44764879 TGACAGGGCTGAGAAATGACAGG + Intronic
1024672245 7:51606770-51606792 TTACAAATGTGGGAAATGAGGGG + Intergenic
1025613895 7:63101697-63101719 TTATACAGCTGGTAAGTGGCAGG - Intergenic
1028223829 7:88226726-88226748 TTCCATAGCTGGGAAATCAGTGG + Intronic
1029169817 7:98622546-98622568 TCACACAGCTAGTGAATGACAGG - Intronic
1029673167 7:102047999-102048021 TGACACAACTGGAAAAAGACTGG - Intronic
1029800866 7:102946335-102946357 TCACACAGCTGGCAAGTGGCAGG + Intronic
1030460970 7:109836089-109836111 TTACAAAGTGGGAAAATGACTGG + Intergenic
1031906250 7:127463220-127463242 TTATAAAGATGGGAGATGACAGG + Intergenic
1032560247 7:132883402-132883424 TTACACAGCAGGGAAATGCCAGG + Intronic
1032635923 7:133708707-133708729 TTACACAGCTTGTAAGTAACTGG + Intronic
1035300055 7:157891285-157891307 TTGCACAGACAGGAAATGACAGG + Intronic
1036464404 8:8983000-8983022 TTTAAGAGCTGGGAATTGACTGG - Intergenic
1036631433 8:10518692-10518714 TCATACAGATGGGACATGACAGG + Intergenic
1037440526 8:18911449-18911471 TTACACAGCAAGGAAGTCACGGG - Intronic
1038025203 8:23582207-23582229 TTCCTCAGCTGCGAAATGAAAGG + Intergenic
1038779260 8:30556700-30556722 TGAGACAGGTGGGAAAGGACGGG - Intronic
1039407705 8:37327149-37327171 TGGCACAGCTGTGAAATGAGGGG - Intergenic
1039589552 8:38735205-38735227 TTCCAAAGCTGTGAAATGAAGGG - Intronic
1041681767 8:60600828-60600850 TTACACAGATGGGATAATACAGG - Intronic
1042732577 8:71953842-71953864 TCACCCAGTTGGTAAATGACTGG - Intronic
1045008284 8:97935232-97935254 TTACACAACTGGAAATTGTCAGG + Intronic
1045497519 8:102720874-102720896 CTACACAGCTGGGAGGTGAAAGG + Intergenic
1045826790 8:106407599-106407621 TCACATAGCTGGGTAATGATTGG + Intronic
1046321537 8:112583112-112583134 TTACAAAGGTGAGAAATGATTGG + Intronic
1047925619 8:129679699-129679721 TTACATAGCTAGGAAGTGACAGG - Intergenic
1048125583 8:131631728-131631750 AAACACAGCTGGGAAGTGATAGG + Intergenic
1048971881 8:139649716-139649738 TTACACAGCTGAGAATTGATAGG - Intronic
1049204257 8:141356079-141356101 GGCCACAGCTGGGAAATGGCAGG - Intergenic
1050267297 9:3904801-3904823 TTACACAGCTACTAAATGTCAGG + Intronic
1050828894 9:9986244-9986266 TTCCACATCTAGGAAATAACTGG + Intronic
1050922409 9:11221124-11221146 TCACACAGCTGAAAAGTGACAGG + Intergenic
1051167506 9:14280030-14280052 TGACACACTTTGGAAATGACAGG + Intronic
1052237294 9:26226788-26226810 TTATACAGCTGAGAATTCACTGG - Intergenic
1052255720 9:26454169-26454191 TTACACAGCTGGTAAGTGGCAGG - Intergenic
1054510169 9:65966750-65966772 TTTCACTGCTGGGAGATTACAGG + Intergenic
1055145673 9:72931760-72931782 GTACCCAGTTGGGAAATGAGAGG - Intronic
1056119347 9:83471888-83471910 TTACATAGTTAGGAAATGACAGG - Intronic
1056457368 9:86773614-86773636 TCACACAGCTGGTAAGTGTCAGG + Intergenic
1057144272 9:92747887-92747909 GCACACAGCTGGGAGGTGACAGG + Intronic
1057633510 9:96740666-96740688 TTACTCATCTGGTAAATGACAGG + Intergenic
1057705005 9:97389824-97389846 TTACACACCTTGGAAATTTCTGG + Intergenic
1057902215 9:98958207-98958229 TTCCCCATCTGGGAAATGAAGGG + Intronic
1058317574 9:103587260-103587282 TTACACAGCTGGATGATGCCAGG - Intergenic
1058783808 9:108365802-108365824 TTACACAGCTAGAAAGTGGCTGG - Intergenic
1058913338 9:109541398-109541420 TCACACAGCTGGTAAGTGACAGG + Intergenic
1060034238 9:120241494-120241516 TGATACTGCTGTGAAATGACAGG - Intergenic
1060280400 9:122212235-122212257 TCACACAGCTAGTAAATGGCAGG + Intronic
1060392119 9:123286619-123286641 TCACACAGCTGAGAGAGGACAGG + Intergenic
1060422491 9:123479390-123479412 TTAGAAAGCTGGGAAATGGATGG + Intronic
1060840569 9:126789974-126789996 TCACACAGCTGGTAAGTGATGGG - Intergenic
1061538977 9:131267117-131267139 TCACACAACTGGGAAGTAACTGG + Intronic
1062097735 9:134711626-134711648 TCACACAGCTGGGAACAGTCAGG + Intronic
1062186193 9:135219928-135219950 CCACACAGCGGGGAAATGGCAGG + Intergenic
1186903686 X:14087576-14087598 TTACACAGCTAACAAGTGACAGG - Intergenic
1188247912 X:27856546-27856568 TCACACAGCTAGTAAGTGACAGG + Intergenic
1189488984 X:41454993-41455015 TGACACAGCTGTGAAAACACTGG - Intronic
1190736054 X:53256562-53256584 TCACACAGCTGGGACAGGGCTGG - Intronic
1191683752 X:63868043-63868065 TTACACAGCTGAGAAGTGTTAGG + Intergenic
1191736180 X:64390546-64390568 TTTCACATCTGTGAAATGAGAGG + Intronic
1191853326 X:65602366-65602388 GCATACAGCTGGGAAATGATGGG - Intronic
1192036044 X:67564010-67564032 CCACACAGCTGGCAAATGGCAGG + Intronic
1192131535 X:68556366-68556388 TTAAACATCTGGAAAATAACAGG + Intergenic
1192543620 X:71995209-71995231 TTACCCAGGTGAGAGATGACAGG - Intergenic
1194204940 X:91001834-91001856 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1194650323 X:96506578-96506600 TCACACAGCCGGTAAATGGCAGG - Intergenic
1194766974 X:97852902-97852924 TTACACACCTGGGAAATGCCCGG - Intergenic
1196334205 X:114511544-114511566 TTACACAATTGGGGAATGGCAGG - Intergenic
1196650714 X:118165742-118165764 TCACACAGCTGGGAAGTAAGTGG - Intergenic
1196663167 X:118289725-118289747 ACACACAGCTAGCAAATGACAGG + Intergenic
1197829698 X:130628281-130628303 TCACACAGCTGGTAAGTGGCAGG + Intronic
1199769945 X:150968910-150968932 TCACATAGCTGGTAAGTGACAGG + Intergenic
1200550766 Y:4576977-4576999 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1202273030 Y:23088614-23088636 TTACACAGCTTGGAAATGAGAGG - Intergenic
1202292996 Y:23332068-23332090 TTACACAGCTTGGAAATGAGAGG + Intergenic
1202426027 Y:24722358-24722380 TTACACAGCTTGGAAATGAGAGG - Intergenic
1202444762 Y:24947728-24947750 TTACACAGCTTGGAAATGAGAGG + Intergenic