ID: 1094371036

View in Genome Browser
Species Human (GRCh38)
Location 12:29737700-29737722
Sequence TGGTGGAATCAGATGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094371029_1094371036 2 Left 1094371029 12:29737675-29737697 CCTCTACAGCCTGGGGCAGCCTA 0: 1
1: 0
2: 1
3: 31
4: 308
Right 1094371036 12:29737700-29737722 TGGTGGAATCAGATGGATGTGGG 0: 1
1: 0
2: 0
3: 15
4: 227
1094371025_1094371036 16 Left 1094371025 12:29737661-29737683 CCATAAGGGCTTGACCTCTACAG 0: 1
1: 0
2: 2
3: 11
4: 178
Right 1094371036 12:29737700-29737722 TGGTGGAATCAGATGGATGTGGG 0: 1
1: 0
2: 0
3: 15
4: 227
1094371024_1094371036 26 Left 1094371024 12:29737651-29737673 CCAGAAAACACCATAAGGGCTTG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1094371036 12:29737700-29737722 TGGTGGAATCAGATGGATGTGGG 0: 1
1: 0
2: 0
3: 15
4: 227
1094371032_1094371036 -7 Left 1094371032 12:29737684-29737706 CCTGGGGCAGCCTAGATGGTGGA 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1094371036 12:29737700-29737722 TGGTGGAATCAGATGGATGTGGG 0: 1
1: 0
2: 0
3: 15
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094371036 Original CRISPR TGGTGGAATCAGATGGATGT GGG Intronic
900731430 1:4263872-4263894 TGGTGGGAGCAGATGGGGGTGGG + Intergenic
902204206 1:14855421-14855443 GGGTGGAGTCAGATGTGTGTTGG - Intronic
902828824 1:18996490-18996512 TGTTGGAATCGGATAGGTGTGGG - Intergenic
903360682 1:22775186-22775208 TTGTGAAAATAGATGGATGTGGG + Intronic
904863754 1:33560406-33560428 AGGGGGAATCAGAGGGATGCAGG - Intronic
904943033 1:34177931-34177953 TGGTGGATCCAGATGTATCTGGG - Exonic
906064161 1:42968311-42968333 TAGTGGGTTCAGATGGATGATGG - Intergenic
906766311 1:48438000-48438022 TGGACCAATCAGAAGGATGTGGG + Intronic
907727667 1:57034982-57035004 TGGTGGAAACAGGTGGTTGGTGG - Intronic
908715651 1:67067172-67067194 AGGTGGTCTCAGATGGAGGTGGG + Intergenic
909835946 1:80254859-80254881 TGGTGAATTTAGATGGTTGTTGG - Intergenic
915315110 1:155024072-155024094 TGCTGAAATCAGAGGGATGGAGG - Intronic
915628861 1:157136816-157136838 AGTGGGAATCAGATGGATTTGGG - Intronic
917343671 1:174006509-174006531 TTTTGGAGTCAGATAGATGTGGG - Intronic
917832745 1:178910746-178910768 TTTTGGAATCAGAATGATGTTGG + Intronic
917969494 1:180197707-180197729 TGGTGGCATGGGAAGGATGTGGG + Exonic
920492407 1:206427400-206427422 TGGAGGAAGCAGATGGGTTTGGG + Intronic
920706887 1:208257969-208257991 TGGTGGAAAGAGATGGCAGTTGG - Intergenic
920998183 1:211015158-211015180 TGGTGGAGGTAGATGGAGGTGGG - Intronic
922653983 1:227364881-227364903 TGGTGGAATCAGAAGCAAGGTGG + Intergenic
924301950 1:242648792-242648814 TCATGGAAACAGATGAATGTGGG - Intergenic
1064535855 10:16357109-16357131 TGGTGGAATCACTTGAATCTGGG - Intergenic
1067797867 10:49333835-49333857 TGGTGGGTGCAGATGGATGATGG - Intergenic
1068259749 10:54564133-54564155 TGGTGGATTCAGTATGATGTGGG - Intronic
1068711916 10:60144511-60144533 TGGTGGGATCAGGTAGATTTGGG - Intronic
1071055414 10:81503569-81503591 TGGTCCAATCAGCAGGATGTGGG + Intergenic
1071307463 10:84311733-84311755 TGGACGAATCAGCAGGATGTGGG - Intergenic
1071452405 10:85810098-85810120 TGGTGGAATCCCATGGTTGGAGG - Intronic
1071452439 10:85810242-85810264 TGGTGGAATCCCATGGTTGGAGG - Intronic
1073470983 10:103721898-103721920 TGGGAGAAACAGATGAATGTGGG + Intronic
1073622946 10:105067660-105067682 TGGAGGAACCAGATGGGAGTGGG - Intronic
1073679424 10:105686272-105686294 TGGTGGTAGCAGATGGATAGGGG - Intergenic
1073878439 10:107951604-107951626 TGGACGAATCAGCAGGATGTGGG + Intergenic
1074536314 10:114330702-114330724 TTGTAAAATCATATGGATGTGGG - Intronic
1074667338 10:115743286-115743308 TGGTAGTATCAGATCCATGTAGG - Intronic
1075194197 10:120340783-120340805 TGGTGCACTCACATGGCTGTGGG + Intergenic
1076657360 10:132033603-132033625 GCGTGGAAACAGATGGATGATGG + Intergenic
1077869050 11:6246144-6246166 GGGTGGCATCTGATGGATTTAGG + Intergenic
1078636483 11:13054988-13055010 TGGTCCAGTCAGATGGATGGTGG + Intergenic
1079239067 11:18709639-18709661 TGGAGGAATCAGATACATGCAGG + Exonic
1079703016 11:23572826-23572848 TGTTGAAGTCAGATGGCTGTAGG + Intergenic
1079814282 11:25035952-25035974 TTTTGATATCAGATGGATGTTGG + Intronic
1080958134 11:37125488-37125510 TAGTGGAATCAGATGGCAGGAGG - Intergenic
1085141619 11:74149171-74149193 TGGAGGAAACAAGTGGATGTGGG - Intronic
1087682204 11:101230590-101230612 TGGACGAATCAGCAGGATGTGGG - Intergenic
1091820453 12:3471820-3471842 TGGTGGAATCAGCTGCAGCTGGG + Intronic
1091901359 12:4146604-4146626 TGAAGAAAGCAGATGGATGTGGG + Intergenic
1093501961 12:19823522-19823544 TGGACCAATCAGAAGGATGTGGG + Intergenic
1093610756 12:21152619-21152641 TGGTAGAGTGAGATGGATTTTGG + Intronic
1094171490 12:27497442-27497464 TGGTAAAATCAGATGGAGGCTGG + Intronic
1094371036 12:29737700-29737722 TGGTGGAATCAGATGGATGTGGG + Intronic
1095237720 12:39818196-39818218 TGGGGGAATCAGATGATTTTAGG - Intronic
1099558872 12:84148047-84148069 TGGTGGTCTCAGATGGAAATAGG + Intergenic
1100343319 12:93702409-93702431 TGGGGAAATCTGGTGGATGTGGG - Intronic
1101752728 12:107596257-107596279 GGGTGGATTCAGTTGGATGTGGG + Intronic
1104404896 12:128509054-128509076 AGTGGGAATCAGAAGGATGTTGG + Intronic
1106175708 13:27329417-27329439 CTTTGGAATCAGATGGATCTGGG + Intergenic
1108406781 13:50111501-50111523 TTGGGGAATCGGATAGATGTAGG + Intronic
1108762671 13:53588632-53588654 TGGTGGAAGCAAAGGGATATAGG - Intergenic
1109072127 13:57783745-57783767 TTTTGGAATCAGAATGATGTTGG + Intergenic
1110298656 13:73899321-73899343 AGGTGGAAACAGACGGATATGGG - Intronic
1117461832 14:55952931-55952953 TAGGGGAATCAGATGGAGGTGGG + Intergenic
1119501856 14:75135508-75135530 TGGTGCTATCAGTTTGATGTGGG + Intronic
1119639212 14:76302110-76302132 TTGGGGAATGAGATGGATGATGG + Intergenic
1120258377 14:82149782-82149804 TGTTGCATTCAGATGGATCTAGG + Intergenic
1120917230 14:89720842-89720864 TGCTGGAATCAGGTAGATGTGGG - Intergenic
1121336140 14:93078582-93078604 CCGTGGAAGCAGATGGATATTGG - Intronic
1124533057 15:30522925-30522947 AGGTGGACTCAGATGGGTGCTGG + Intergenic
1124661790 15:31555732-31555754 CGGAGGAGTCAGATGGATGGTGG + Intronic
1125452313 15:39822097-39822119 TGGTGCATTCACATGGCTGTTGG - Intronic
1126358305 15:47819323-47819345 TGGTGCACTCACATGGCTGTTGG - Intergenic
1127195771 15:56583899-56583921 GGGTGGTATCAGTTTGATGTTGG - Intergenic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1129987015 15:79926849-79926871 TGGACCAATCAGAAGGATGTGGG + Intergenic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1131073338 15:89479588-89479610 AGGTGGAAACAGCTGGGTGTGGG - Intronic
1131702044 15:94947914-94947936 TGGTGCAATCAGATTAATGCTGG + Intergenic
1133180375 16:4049697-4049719 TGGAAGAATCAGCTGGTTGTTGG - Intronic
1138526262 16:57609135-57609157 TGCTGGAATCTGATGGGTCTGGG + Intergenic
1139002633 16:62531671-62531693 AGGTTTAATCAAATGGATGTTGG + Intergenic
1139915996 16:70428832-70428854 AGGTGGAATCAGACTGATCTGGG - Intronic
1144214047 17:13039096-13039118 AGGAGGAAGCAGATGGATATTGG + Intergenic
1144627067 17:16849441-16849463 TGGTGCGATGAGATGGACGTGGG + Intergenic
1144879374 17:18423271-18423293 TGGTGCGATGAGATGGACGTGGG - Intergenic
1145152866 17:20521116-20521138 TGGTGCGATGAGATGGACGTGGG + Intergenic
1146948795 17:36891703-36891725 TGGTGGAGTAAGATGGAATTTGG + Intergenic
1147007394 17:37414750-37414772 TAGTGGAATTATATTGATGTTGG - Intronic
1147180987 17:38685636-38685658 GGGTGGAAGCAGATGGAAGCGGG - Intergenic
1148857760 17:50588296-50588318 TCTTGGAGTCAGAGGGATGTGGG + Intronic
1149132193 17:53316213-53316235 TGGTGGAACCACATGGAGTTTGG - Intergenic
1149209336 17:54286385-54286407 TGGATCAATCAGAAGGATGTGGG + Intergenic
1154223518 18:12478783-12478805 TGGGGGCTTGAGATGGATGTGGG + Intronic
1155071659 18:22322112-22322134 TTGTGGAATCACATGGAAGAAGG + Intergenic
1155298701 18:24409134-24409156 TGGTTGAATGAGAGGGATGAGGG + Intergenic
1156969805 18:43140427-43140449 TGGATGAATCAGCAGGATGTGGG + Intergenic
1158245835 18:55431252-55431274 AGGTGGAATCAAAGGGATGTAGG - Intronic
1161120050 19:2520729-2520751 TGGGGGAAGCAGAGGGGTGTGGG + Intronic
1163050370 19:14678788-14678810 TGGTGGAATTAGCTGGCTATTGG + Intronic
1166935569 19:46330468-46330490 TGGATGAATCGGATGGATGGAGG + Intronic
1167525380 19:49980384-49980406 AGGTAGAATGAGATGTATGTAGG + Intronic
1167634168 19:50644301-50644323 TGGATGGATAAGATGGATGTTGG + Intronic
1168572177 19:57480438-57480460 TGGGAGAATCAGAAGCATGTTGG + Intergenic
925655838 2:6148051-6148073 TTGTGGAATCACATGGTTCTTGG - Intergenic
926162078 2:10496151-10496173 GGGTGGGATCAGATGGAGGTGGG - Intergenic
926437517 2:12853269-12853291 TGGAGCAATCAGCAGGATGTGGG - Intergenic
927137306 2:20106360-20106382 TGGTCCAATCAGCAGGATGTGGG - Intergenic
929070181 2:38021303-38021325 TGGAGCAATCAGCAGGATGTGGG + Intronic
929951392 2:46412234-46412256 TGTTGGAACCAGAGGGATGCTGG + Intergenic
930525511 2:52524720-52524742 AGGAAGAATCAGCTGGATGTTGG + Intergenic
931233165 2:60391276-60391298 TGGTGGAGTCAGGGGGAAGTGGG - Intergenic
931501941 2:62878470-62878492 TTTTGGTATCAGAAGGATGTTGG - Intronic
931538855 2:63306395-63306417 TGTTGGAATCAGGTTGATGCTGG - Intronic
933506432 2:83181748-83181770 TGGAGCAATCAGCAGGATGTGGG + Intergenic
934618848 2:95791966-95791988 TTGTGGGATCAGTTGGGTGTGGG + Intergenic
934642045 2:96032591-96032613 TTGTGGGATCAGTTGGGTGTGGG - Intronic
936578396 2:113674252-113674274 AGGTGGAAAGAGATGGTTGTTGG + Intergenic
937039618 2:118810805-118810827 GGGTGGAGTCAGCTGGCTGTGGG - Intergenic
937630897 2:124099893-124099915 TGATTGGATCAGATGGATGGAGG - Intronic
938653069 2:133403730-133403752 TGGTGGAATGAGATGGGACTTGG - Intronic
939842414 2:147205535-147205557 TGGTGGAATGATATGGTTGGCGG - Intergenic
939863271 2:147444168-147444190 TTGTGATATCAGGTGGATGTGGG - Intergenic
943578754 2:189660201-189660223 TGGTGGTATCTGTTGGATGATGG - Intergenic
944323805 2:198379459-198379481 TGGTAAAATCAGATTAATGTTGG + Intronic
947812690 2:233014541-233014563 TGTGGCAATCAGATGGCTGTGGG - Intronic
948049397 2:234968039-234968061 TGGTGGAACCAGGTGGACCTGGG - Intronic
948278083 2:236725371-236725393 TGATGAAATCAGATGAATCTTGG - Intergenic
948885926 2:240884637-240884659 TGGGGGACTCAGAAGGCTGTTGG - Intergenic
1170562415 20:17569426-17569448 TGGTGGAAGGAGAGAGATGTTGG - Intergenic
1172596660 20:36154906-36154928 TGGGGGAATCAGGTGGCTCTCGG + Intronic
1173317064 20:41954594-41954616 TGAGGGGAGCAGATGGATGTGGG + Intergenic
1175845268 20:62054914-62054936 TTGTGGAATGAGATTGAGGTGGG - Intronic
1176668557 21:9710514-9710536 TTGTGGACTCACATGGATCTTGG + Intergenic
1178501042 21:33125706-33125728 TGGCTGAATGAGATGGATGTGGG - Intergenic
1178723063 21:35027178-35027200 TAGTGGAATCAGTTTCATGTGGG - Intronic
1182907866 22:33954039-33954061 TGGGTTAATCACATGGATGTTGG + Intergenic
1183950072 22:41347832-41347854 TGGTGGGATCAGAGGGAGGGAGG + Intronic
950523196 3:13508500-13508522 TGTTGGAGTCGGATGGATGTGGG - Intergenic
950781690 3:15398000-15398022 GGGTGCAATCATAGGGATGTGGG - Intronic
953564958 3:44023845-44023867 TGGTGGTATCATATTCATGTTGG + Intergenic
959753646 3:109869520-109869542 TGGTGGAATCAGATCTAGGCTGG + Intergenic
962299132 3:134222075-134222097 TGGTGAAAGGAGATGGGTGTAGG - Intronic
965266635 3:166552155-166552177 TGCTGAAATCAGATGGTTCTTGG - Intergenic
967241428 3:187443489-187443511 TGATTTACTCAGATGGATGTTGG - Intergenic
969328757 4:6460830-6460852 TTGTGGAACCAGATGGAGATGGG - Intronic
969599401 4:8167013-8167035 TGATAGAAACAGATGGATGGTGG - Intergenic
970182704 4:13416103-13416125 TGGAGCAATCAGCAGGATGTGGG + Intronic
973033411 4:45373270-45373292 TGATGGAATTGGATGGAGGTGGG + Intergenic
973045512 4:45531439-45531461 TGGGCCAATCAGCTGGATGTGGG + Intergenic
973764173 4:54148843-54148865 TGGGCGAATCAGCAGGATGTGGG - Intronic
974493250 4:62594192-62594214 TGGTGGCATGAGAGGGATATAGG + Intergenic
976095193 4:81501219-81501241 TGGAGGAATGAGAAAGATGTGGG - Intronic
979507197 4:121512120-121512142 TGTTTCAATCAGATGGCTGTAGG - Intergenic
982647795 4:158044995-158045017 TGGAGCAATCAGCAGGATGTGGG + Intergenic
983770547 4:171543832-171543854 TGTTGGAAACAGAGGGATTTGGG - Intergenic
984998937 4:185465890-185465912 TGGTGAGAGCAGATGGATGAGGG + Intronic
985406225 4:189641013-189641035 TTGTGGACTCACATGGATCTTGG - Intergenic
985967336 5:3347715-3347737 TGAAGGAGGCAGATGGATGTTGG + Intergenic
986557591 5:9026870-9026892 AGGTGGTCTCAGATGGAGGTGGG + Intergenic
988417047 5:30958713-30958735 TGGGAAAATAAGATGGATGTAGG + Intergenic
989547162 5:42688204-42688226 TGATGACATCAGGTGGATGTGGG - Intronic
992067573 5:73121675-73121697 TGATAGAATCAGAAGGAAGTTGG - Intronic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
993726335 5:91371368-91371390 TGGTTGAATCAAGTTGATGTGGG - Exonic
994805094 5:104436119-104436141 GTCTGGAATCAGATGGATGTTGG - Intergenic
995957844 5:117801227-117801249 TGTTGAAATCAGATGGTTGTAGG - Intergenic
996122986 5:119692051-119692073 AGGTGGCCTCAGATGGAGGTGGG - Intergenic
999243262 5:150139568-150139590 TCGTGGAATGAGATGGCTGGTGG - Intronic
999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG + Intronic
1000111798 5:158115134-158115156 AGGTGGAAACAGGTGGAGGTGGG + Intergenic
1000307813 5:160011718-160011740 TTGTGCAATCAGAAGGAAGTAGG - Intronic
1001021426 5:168186158-168186180 CTCTGGAATCAGATGGATTTGGG - Intronic
1002579881 5:180201488-180201510 TGGTGGTAACAGATGGCTGCAGG - Intronic
1003074145 6:2968927-2968949 GGGTGGAAGCAGATGGGGGTCGG + Intronic
1003907912 6:10719721-10719743 TGGACCAATCAGCTGGATGTGGG - Intergenic
1006113051 6:31760347-31760369 AGGTGGAAGCACAGGGATGTGGG - Intronic
1010084379 6:71899730-71899752 TGTTGGGATCATATGGATGTAGG - Intronic
1010314547 6:74431601-74431623 AGGTGAAATCAGATGCATGTTGG - Intergenic
1010485012 6:76400428-76400450 TGGATGAATCAGATGGAGGGAGG - Intergenic
1010759725 6:79708709-79708731 TGCTGGAATCAGATAGATGCAGG + Intergenic
1011191933 6:84738552-84738574 TGGTGGAATCATATGCATTCTGG - Exonic
1011959316 6:93068163-93068185 TAGTAGAATCATATGGATGAGGG + Intergenic
1013098917 6:106971741-106971763 TGGTGGCATTAGTTGGATTTGGG + Exonic
1016790312 6:148060703-148060725 TGATGGTCTCAGATGGAGGTGGG - Intergenic
1017779988 6:157708262-157708284 GGGTGCAATCAGAGGGGTGTGGG + Intronic
1019326985 7:443359-443381 TGGTGGATGGAGATGGATGGAGG + Intergenic
1019820831 7:3241613-3241635 AGCTGGAATCAGAGGCATGTAGG + Intergenic
1020950862 7:14675297-14675319 TGTTGGAAACACATGGATGGAGG - Intronic
1020987970 7:15159879-15159901 TGGAGGAATAATATGGGTGTAGG - Intergenic
1021136007 7:16965860-16965882 TGGACCAATCAGCTGGATGTGGG + Intergenic
1021356932 7:19660888-19660910 TGGACCAATCAGCTGGATGTGGG - Intergenic
1022082222 7:27034072-27034094 TAGTGCAAGCAAATGGATGTGGG - Intergenic
1022451654 7:30521752-30521774 TGGTGTACTCACATGGCTGTTGG + Intronic
1023037593 7:36147125-36147147 TGGTGGGATCAGCTGAAGGTGGG - Intergenic
1023088830 7:36599342-36599364 TGGCAGAATCAGATGAATGAGGG - Intronic
1023337048 7:39181174-39181196 TGATGGCATCAGAAGGAGGTTGG + Intronic
1023956669 7:44892017-44892039 TGGAGGCAGCAGATGGAAGTGGG + Intergenic
1024235813 7:47396951-47396973 TGGTGGAGTCGGTTGGATGGAGG - Intronic
1026312254 7:69196549-69196571 TGTTGGAATCAGAAAGTTGTGGG - Intergenic
1028513622 7:91652058-91652080 TCCTGTAATCAGATGGGTGTGGG - Intergenic
1029245446 7:99196234-99196256 TGTTTTAATCAGATGGATGATGG - Intronic
1032082685 7:128867913-128867935 TGCTGGAATCTGATGGGAGTGGG + Intronic
1032124227 7:129180515-129180537 TGGTACCATAAGATGGATGTTGG + Intergenic
1039131297 8:34267357-34267379 TGGGGGAGTAAGATGGAAGTGGG - Intergenic
1040704180 8:50105318-50105340 TGTTGAAATCAGATGGTTGTAGG + Intronic
1041053549 8:53960225-53960247 TGTTGGAATCAGTTGGATGGAGG + Intergenic
1041934699 8:63322362-63322384 TGGTGGAATGAGGTGGAGTTTGG + Intergenic
1043597846 8:81904713-81904735 TGGACCAATCAGCTGGATGTGGG + Intergenic
1043679591 8:83006140-83006162 TGGTGAAACCAGATTGAAGTGGG - Intergenic
1047925979 8:129683065-129683087 TGTTGGAATCACCTGGGTGTGGG - Intergenic
1048435130 8:134409272-134409294 CTGAGGAAGCAGATGGATGTTGG + Intergenic
1049906834 9:225522-225544 TAAAGGAATCAGCTGGATGTGGG + Intronic
1050746661 9:8884161-8884183 TGAAGGAATCAGATGGAGCTAGG - Intronic
1051617686 9:19021889-19021911 TGGACCAATCAGAAGGATGTGGG + Intronic
1052370574 9:27659931-27659953 TGTTGGAGTCAGAGAGATGTGGG + Intergenic
1052467192 9:28843853-28843875 TAGTGGAATCAGAACGATTTAGG + Intergenic
1053421602 9:37983387-37983409 TGCTGGAGGCAGATGGAAGTGGG + Intronic
1053608761 9:39688172-39688194 TGGTGGAATCAGATGGGCTATGG - Intergenic
1053866606 9:42444538-42444560 TGGTGGAATCAGATGGGCTATGG - Intergenic
1054244763 9:62654226-62654248 TGGTGGAATCAGATGGGCTATGG + Intergenic
1054558890 9:66688769-66688791 TGGTGGAATCAGATGGGCTATGG + Intergenic
1054920128 9:70535378-70535400 TGTTGGCATGAGAAGGATGTGGG + Exonic
1055367027 9:75555633-75555655 TAGTGGAATCAGATGACTTTTGG + Intergenic
1055531552 9:77189392-77189414 TGTTAAAATCAGATGGTTGTAGG + Intronic
1057472027 9:95366670-95366692 TGATTGAATGAAATGGATGTAGG + Intergenic
1058540107 9:106002888-106002910 TGGGTGAGTCAGATGGTTGTTGG + Intergenic
1058869666 9:109191065-109191087 TGGGGGAAGCAGATGGAGGGAGG + Intronic
1062011076 9:134267190-134267212 TGCTGAAATCAGGTGGAGGTGGG + Intergenic
1203657309 Un_KI270753v1:10427-10449 TTGTGGACTCACATGGATCTTGG - Intergenic
1189712595 X:43828726-43828748 TGGTGGAGTGAGATGGATCAGGG + Intronic
1192184257 X:68935951-68935973 TGGTGAACTCACAGGGATGTAGG + Intergenic
1192632870 X:72790646-72790668 AGGTGGGATCAGATAGATGCAGG - Intronic
1192648839 X:72930155-72930177 AGGTGGGATCAGATAGATGCAGG + Intronic
1193971509 X:88060766-88060788 CGGTGGAATCATAAGGATTTGGG + Intergenic
1193987797 X:88267748-88267770 TGGAGTAAGCAGATGGAAGTAGG - Intergenic
1196327913 X:114429776-114429798 TGGGGGAAATAGACGGATGTTGG + Intergenic
1197346363 X:125328132-125328154 TGGTCGAATCCTATGGATGAGGG - Intergenic
1197608052 X:128607332-128607354 TGGACGAATCAGCAGGATGTGGG + Intergenic
1198270986 X:135055848-135055870 TGGTGGAATGACATGGAATTTGG + Intergenic
1199807194 X:151311950-151311972 TTTTGGAATCAGATAGATCTAGG + Intergenic
1199942897 X:152641909-152641931 TGGTGTACTCAAATGGTTGTTGG - Intronic
1200813723 Y:7510186-7510208 TGGTGGAATCATGTGGTTGAGGG - Intergenic
1200818843 Y:7561598-7561620 TGGTGGAATCACTGAGATGTGGG - Intergenic
1201895843 Y:18992547-18992569 TGGTGGCATTAGTTGGATTTGGG + Intergenic