ID: 1094374605

View in Genome Browser
Species Human (GRCh38)
Location 12:29776756-29776778
Sequence GATCACCTGGCCACCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094374605 Original CRISPR GATCACCTGGCCACCAGGGA AGG Intronic
900323723 1:2097255-2097277 GGCCACATGGCCACCTGGGAAGG + Intronic
901304214 1:8220901-8220923 GCTCTCCTGGCCCCCAGGGCAGG - Intergenic
902245316 1:15116991-15117013 GCTCACCTGGCTGTCAGGGATGG - Exonic
904111413 1:28129211-28129233 GATCACAAGGGGACCAGGGAAGG + Intergenic
904307645 1:29600473-29600495 AATCATCTGGCCACCAAGAAGGG - Intergenic
905403681 1:37719602-37719624 GATCACCTGGGCCACAGGGGTGG + Exonic
905873763 1:41419280-41419302 GGGCACTTGGCCACCAGGGGAGG + Intergenic
906187962 1:43876103-43876125 GATTACCTTGCCACCATGGCAGG + Intronic
907591799 1:55681011-55681033 GATCACCTGGACACAGGGCAGGG - Intergenic
908838459 1:68253079-68253101 GAACACATGGACACAAGGGAAGG - Intergenic
915726108 1:158018737-158018759 CATCAGATGGCCTCCAGGGAAGG - Intronic
916167258 1:161975253-161975275 GACCACCTTGTCACCAGGGTCGG - Intergenic
917961654 1:180150528-180150550 GGTGACCTGGGGACCAGGGAAGG + Intergenic
920543285 1:206795162-206795184 TAACACCTGGCCACCAAGGCTGG + Intergenic
923498472 1:234544922-234544944 GCTCAGCCGGCCACCTGGGAAGG - Intergenic
1062967421 10:1618629-1618651 CATCACCTGAGCCCCAGGGATGG - Intronic
1064466057 10:15583316-15583338 GAGCACGTGGACAACAGGGAGGG + Intronic
1066448063 10:35502094-35502116 CTGCACCTGGCCACCAGGGGAGG - Intronic
1067017008 10:42765224-42765246 GAACGCTTGGACACCAGGGACGG + Intergenic
1067062962 10:43087399-43087421 TGTCACCAGGACACCAGGGAAGG + Intronic
1067511221 10:46896373-46896395 GCTGACCTGGTCACCAGGCAGGG + Intergenic
1067651032 10:48155489-48155511 GCTGACCTGGTCACCAGGCAGGG - Intergenic
1068123212 10:52806107-52806129 GATCACCTGGCGCACGGGGATGG + Intergenic
1068736526 10:60419466-60419488 GAGCACCTGGCCTCCTGGGCTGG + Intronic
1069223258 10:65910034-65910056 GGTCAACTGGCCAGCATGGAGGG - Intergenic
1069913136 10:71771936-71771958 TCTCACAGGGCCACCAGGGAGGG + Intronic
1069937445 10:71927452-71927474 GGCCACCTGGCCACCTGGGTGGG + Intergenic
1071481096 10:86065517-86065539 GAGCACCTGGCCACAGGGCAGGG - Intronic
1074102423 10:110364283-110364305 CAACACCTGGCCAGAAGGGAAGG - Intergenic
1074396761 10:113104425-113104447 TGTCATCTGGACACCAGGGAGGG + Intronic
1074657105 10:115603190-115603212 TATCCCCTGTCCTCCAGGGAGGG - Intronic
1075911186 10:126127025-126127047 GATCCACTGGCCACCAGCCACGG - Intronic
1076129192 10:128001241-128001263 CATCACATGGAAACCAGGGAAGG + Intronic
1076395339 10:130134826-130134848 GAACACCTGGCTAGTAGGGAAGG + Intergenic
1076526124 10:131113324-131113346 GCTAGGCTGGCCACCAGGGAAGG - Intronic
1076618823 10:131773983-131774005 GATCACTTGTCCTCCTGGGATGG - Intergenic
1077092935 11:787808-787830 GATCACCCAGCCGCCAGGGGTGG + Exonic
1079076391 11:17387778-17387800 GGTGACCTGGCCCCCAGCGAGGG - Exonic
1081808998 11:45904918-45904940 GGTCACCTGGCCTGCAGTGAGGG - Intronic
1083541042 11:63511671-63511693 GCTCCCCTGGCCCCCGGGGATGG + Intronic
1084682336 11:70673673-70673695 GATCACCTGCCCAACCTGGATGG + Intronic
1085334655 11:75682354-75682376 GAACACATGGACAACAGGGAAGG - Intergenic
1085693950 11:78688172-78688194 GCTCACCTGGCCAGTAGGGAAGG + Exonic
1085812938 11:79702063-79702085 GAACTCCTGGCCACAAGTGATGG + Intergenic
1087305401 11:96483772-96483794 GATGACATGGCCACCAGAGGTGG - Intronic
1087574842 11:99976706-99976728 GTGCAACTGGCCACCAGGCATGG + Intronic
1088005526 11:104934670-104934692 GAACACATGGACAACAGGGAGGG + Intergenic
1088470315 11:110182748-110182770 GCTCACCTGGCCTTGAGGGATGG - Intronic
1088538328 11:110885680-110885702 GAACACCTGGACACCATGGTGGG + Intergenic
1089053595 11:115566354-115566376 GATAGCCTGACCAGCAGGGAGGG - Intergenic
1089312856 11:117571547-117571569 GCTCACCTGGGCTCCAGGGCAGG - Intronic
1089626717 11:119755576-119755598 GTGCCCCTGGCCAACAGGGATGG + Intergenic
1089678394 11:120105814-120105836 GACTGCATGGCCACCAGGGAAGG + Intergenic
1090086440 11:123654536-123654558 GATCACCTGCCACCCAGGGTCGG - Exonic
1090325167 11:125879735-125879757 CATCTCCCAGCCACCAGGGAGGG - Intergenic
1090495395 11:127206450-127206472 GCTCACCTGGCTACCAGTGGTGG - Intergenic
1093031632 12:14294293-14294315 TGCCACCTGGACACCAGGGAGGG - Intergenic
1094374605 12:29776756-29776778 GATCACCTGGCCACCAGGGAAGG + Intronic
1095402565 12:41831813-41831835 GATTACCTTGCCACCATGCATGG - Intergenic
1095935786 12:47679201-47679223 GATCACCTGGACACAGGGCAGGG + Intronic
1098293457 12:68980849-68980871 CATCACCTGACCTCCAGGGAAGG + Intergenic
1098424539 12:70346222-70346244 GATTACCAGGGCACCAGGCATGG + Exonic
1102252207 12:111394944-111394966 GATCACCTGGGCAACAGGATGGG + Intergenic
1103293266 12:119864825-119864847 GAGCATCTGGGAACCAGGGAAGG - Intronic
1103568264 12:121827916-121827938 GATCACCTGGCCACAAAAGGGGG - Exonic
1104481508 12:129111901-129111923 GACCTCCGTGCCACCAGGGATGG - Intronic
1104963587 12:132499276-132499298 GAGCCGCTGGCCAGCAGGGAAGG + Intronic
1104963611 12:132499360-132499382 GAGCCGCTGGCCAGCAGGGAAGG + Intronic
1105204313 13:18207371-18207393 GACCACACGGCCACCAGGGAAGG + Intergenic
1105431731 13:20343252-20343274 GGTAACCTGGCCCCCAGGAAGGG + Intergenic
1106027779 13:25971721-25971743 AGTCACCGGGCCTCCAGGGAGGG + Intronic
1106368372 13:29106318-29106340 GATCACCTGGCAACCCAGGTTGG + Intronic
1106656571 13:31753006-31753028 GACGACCTGGTCACCAAGGATGG - Intronic
1107387941 13:39932839-39932861 GATCACTTGGACACAAGGCAGGG + Intergenic
1112611956 13:100964008-100964030 GAACACATGGACACCGGGGAGGG - Intergenic
1118921853 14:70156734-70156756 GATCAGCTGTCCAGCAGGGGAGG + Intronic
1121017024 14:90555184-90555206 GGTCAGCTGACCATCAGGGAAGG - Intronic
1122082094 14:99273441-99273463 GATGACCTGGCCTCCAGGGCTGG + Intergenic
1122524560 14:102371534-102371556 GGGCACCTGGCCCCCAGGCATGG + Intronic
1122779512 14:104137796-104137818 GAGCAACTGGTCGCCAGGGAAGG + Intergenic
1124422765 15:29537188-29537210 GATCAACTGGTCCCAAGGGAGGG + Intronic
1130144990 15:81267208-81267230 GCCTACCTGGCCAGCAGGGATGG + Intronic
1136600013 16:31278925-31278947 GAACACTTGGACACCAGGTAGGG - Intronic
1137586430 16:49666709-49666731 GCTCACCAGACCCCCAGGGAGGG + Intronic
1138005350 16:53330703-53330725 GAACACATGGACACCAGGGGAGG - Intergenic
1138214457 16:55191064-55191086 CATCACCTGGCCACCATGATTGG + Intergenic
1140766501 16:78164207-78164229 GATCACATGTGCACCATGGAGGG - Exonic
1141944553 16:87300395-87300417 GATCACCTGAGCCCCAGGGACGG + Intronic
1142257025 16:89018959-89018981 GGTCAGCTGTGCACCAGGGAAGG + Intergenic
1144761490 17:17709985-17710007 GCTCACCTGCCCACCATGGGTGG + Intronic
1145216769 17:21058726-21058748 GCTCTCCAGGCCCCCAGGGAGGG + Intergenic
1146503645 17:33385831-33385853 TATCACCTGGCCTCCAGACAGGG - Intronic
1148714769 17:49708083-49708105 GTTCCCCTGGCCCTCAGGGATGG - Exonic
1149533575 17:57415127-57415149 GATCCTCTGGGCACCAGGGATGG + Intronic
1150267217 17:63839347-63839369 GAGCACCTGCCCAGGAGGGATGG - Intronic
1152461804 17:80445634-80445656 GATCACATGGGCTCCAGGGTTGG + Intergenic
1152597613 17:81245667-81245689 GTTCACCTGGACATCAGGCAGGG + Exonic
1152597624 17:81245710-81245732 GGTCAGCTGGCCCCGAGGGATGG - Exonic
1153535000 18:6092354-6092376 GAGCACCTCCCCACCTGGGATGG + Intronic
1153813135 18:8769644-8769666 GGTCACCAGGCCACCTGGGATGG - Intronic
1154490684 18:14919748-14919770 AGTCACCTGGCCAGCAGGGTGGG - Intergenic
1158548569 18:58416266-58416288 GAACACCTGTCCCCCAGGGTGGG + Intergenic
1160252868 18:77218892-77218914 GAGCACGTGGCCAGCAGTGAAGG - Intergenic
1160702871 19:517094-517116 GAGCACCTGCCCTCCAGGGCCGG - Intronic
1160811952 19:1016679-1016701 GGTCACATGGCCAGGAGGGAGGG + Intronic
1161649735 19:5477076-5477098 GGTCACCTGCCCCCCAGTGACGG + Intergenic
1162514954 19:11142345-11142367 GATCACCCTGCCCCTAGGGAGGG + Intronic
1163696745 19:18768155-18768177 GCTCACTGAGCCACCAGGGATGG + Intronic
1163699932 19:18781933-18781955 GATCTCCTGCCCACCAGGAGGGG + Exonic
1164749551 19:30642404-30642426 CATCAGCTGTCCACCAGAGATGG - Intronic
1165077723 19:33290107-33290129 GGCCACCTGGCCACCAAGGTGGG - Intergenic
1167536173 19:50053229-50053251 GGTCACCTTGCCACCATGGGGGG + Intronic
925204362 2:1993845-1993867 CATTTCCTGGCCCCCAGGGAGGG + Intronic
926961341 2:18361786-18361808 GATCACCTGAGAAGCAGGGAAGG + Intergenic
927455788 2:23248191-23248213 GGACATCTGGCCACCAGGGAGGG + Intergenic
937931392 2:127208162-127208184 GATACCCTGGCTGCCAGGGAAGG - Intronic
939414806 2:141882110-141882132 GATCACCTGTCCACATGAGATGG - Intronic
941918874 2:170829798-170829820 GGAGACCTGGCCAGCAGGGAGGG - Intronic
942556702 2:177178962-177178984 GATCAGTTTGCCACCTGGGAGGG - Intergenic
943164567 2:184304094-184304116 TGTAACCTGGCCTCCAGGGATGG + Intergenic
943367228 2:186977767-186977789 GATCCACAGGCCACCAAGGAAGG - Intergenic
945913685 2:215680274-215680296 GAACACATGGACACCTGGGAGGG + Intergenic
946971815 2:225101911-225101933 GATCACCTGGACACAGGGCAGGG + Intergenic
947688994 2:232117223-232117245 GTTCACCTCTCCATCAGGGAAGG + Intronic
948487500 2:238290032-238290054 ACTCACCTGGGGACCAGGGATGG + Intronic
948708075 2:239807422-239807444 GATCACCAGGACCCCAGGGCTGG + Intergenic
948836408 2:240628184-240628206 GATCTCCTGGCCCCCAGCGGGGG + Intronic
1170315648 20:15038710-15038732 CATCACCTGGCCTCCAGGTTGGG - Intronic
1172100234 20:32480871-32480893 GCCCACCTAGCCACCAGGGAAGG + Intronic
1173707880 20:45125757-45125779 GATCATTTGGATACCAGGGATGG + Intergenic
1175361765 20:58417214-58417236 GATCACATGTCCACCATAGATGG + Intronic
1176713665 21:10330715-10330737 GACCACACGGCCACCAGGGAAGG - Intergenic
1178273102 21:31211669-31211691 GATAAGCTGGACTCCAGGGAAGG + Intronic
1180876511 22:19177605-19177627 GGTCTCCTGGACGCCAGGGAAGG - Intronic
1181629382 22:24142588-24142610 GACCACAGGCCCACCAGGGAAGG - Intronic
1181639465 22:24189102-24189124 GAACACCAGGAGACCAGGGAAGG - Exonic
1184390691 22:44201472-44201494 GAGCACCTGGCCTCCAGGGAAGG - Intronic
1184694802 22:46133340-46133362 GAGTGCCTGGCCCCCAGGGAGGG + Intergenic
949155771 3:826229-826251 GCACCCCTGGACACCAGGGAAGG + Intergenic
949646789 3:6104985-6105007 GATCACCTGGCAGGAAGGGAAGG + Intergenic
950716797 3:14853469-14853491 GCTCACCAGCCCAGCAGGGAGGG - Intronic
953537616 3:43788145-43788167 GACCCCCTGGCCACCAGGCCTGG + Intergenic
953658926 3:44876252-44876274 CATCTCCTGGCCACCAGTGTTGG + Intronic
955361131 3:58275804-58275826 GAACACTTGGACACCAGGCAGGG - Intronic
955637787 3:61048928-61048950 GATCACTTGGACACAAGGCAGGG + Intronic
955977086 3:64489670-64489692 GAGCACCAGGCCACCTGGGTGGG + Intergenic
956315221 3:67927833-67927855 AGTCACCTGGCCACCACGGGGGG + Intergenic
959233039 3:103681817-103681839 GATCCACTGGCAAGCAGGGAAGG - Intergenic
961345566 3:126261123-126261145 GATGAAAGGGCCACCAGGGAGGG - Intergenic
962822110 3:139059303-139059325 GATCACATGGACACTTGGGAGGG - Intronic
963792439 3:149597556-149597578 GATCACCTGAGCTCAAGGGAGGG + Intronic
964887660 3:161503152-161503174 GCTCACCTGGCCTGCACGGAGGG + Exonic
971355690 4:25893469-25893491 GAACACAGGGCCACCAGGTAAGG + Intronic
979774888 4:124577851-124577873 GATCACATGGACACAAGGAAGGG - Intergenic
985611577 5:892489-892511 GAGGTCCTGGCCACGAGGGAGGG - Intronic
985991285 5:3563914-3563936 GATCACCTGGGCACCAACCAGGG + Intergenic
987303616 5:16617802-16617824 GATCACCTAGCCACAAGGAGGGG - Intergenic
990989514 5:61671664-61671686 CATCTCCTCGTCACCAGGGATGG - Intronic
992172780 5:74120901-74120923 GACCACCTGACCTCCAGGGAAGG + Intergenic
992314269 5:75536577-75536599 GCTCACCTGGCTACCAGTGGTGG + Intronic
992865378 5:80952512-80952534 GATCACTTGGACACAAGGCAGGG + Intergenic
993983704 5:94572210-94572232 CATCAACTGGCCAGCAGGGCTGG + Intronic
995303723 5:110617914-110617936 GATCACTTGAGCCCCAGGGATGG + Intronic
996402426 5:123076706-123076728 GAACACCTGCCCTCCAGAGAGGG + Intergenic
997511661 5:134458774-134458796 GAACAGCTGGCCAGCAGGGCTGG + Intergenic
998404793 5:141868242-141868264 GCTCACCTGGCTAGCAGAGAAGG + Intronic
999602082 5:153278169-153278191 GACCACTGGGCCAACAGGGAAGG + Intergenic
1001325217 5:170719028-170719050 GATCACCTGGCTAGAAAGGAAGG + Intronic
1003639136 6:7861999-7862021 GCTGATCTGTCCACCAGGGAGGG + Intronic
1006499849 6:34451142-34451164 GATGTCCTGGCTACTAGGGATGG + Intergenic
1007324521 6:41049811-41049833 GATCAGAGGGCCTCCAGGGATGG + Intronic
1007405661 6:41634770-41634792 GTTCTGCTGGCCACCAAGGAGGG + Intergenic
1009531880 6:64828817-64828839 CTTCAGATGGCCACCAGGGAGGG - Intronic
1010661199 6:78572577-78572599 GATCACTTGGACACAAGGCAGGG + Intergenic
1015029719 6:128580369-128580391 GAGGACTTGGCCACCAGCGAGGG + Intergenic
1015174489 6:130292106-130292128 GAAGAGCTGGCCACCAAGGAAGG + Intronic
1015680250 6:135799514-135799536 ACTCACCTTGCCCCCAGGGAAGG - Intergenic
1019658624 7:2211206-2211228 CAGGGCCTGGCCACCAGGGAGGG + Intronic
1022817214 7:33925045-33925067 GATCTCATGGGCACTAGGGAGGG - Intronic
1023372260 7:39523237-39523259 GAACACTTGGACACAAGGGAGGG - Intergenic
1023505435 7:40895264-40895286 GAGCACATGGACACCAAGGAGGG + Intergenic
1024568750 7:50706887-50706909 GGCCAGCGGGCCACCAGGGATGG - Intronic
1024614998 7:51104592-51104614 AATAACCTGCCCACCAGTGAGGG - Intronic
1027235121 7:76293432-76293454 GCTTAGCTGGCCAACAGGGAGGG + Intergenic
1027739197 7:81978532-81978554 GAACACATGGACACCAGGGAGGG + Intronic
1029795443 7:102889599-102889621 GAACACCTGGACACAAGGCAGGG - Intronic
1033498820 7:141926900-141926922 GAGCACTTGGACACCAGGCAGGG - Intronic
1033596576 7:142863674-142863696 GCTCACCTACCCACCAGGGGGGG + Exonic
1035282107 7:157784923-157784945 GCTCACCTGGCCACTGGGGAGGG - Intronic
1035622566 8:1044897-1044919 GATCATGTGGTCAACAGGGAAGG - Intergenic
1035888812 8:3322645-3322667 GGTCACCTGGCCTCCAGGTGTGG + Intronic
1036971196 8:13356981-13357003 AATCACCTGGCCAGCAGGGCAGG - Intronic
1041624072 8:60005114-60005136 GATCACTTGGACACAAGGCAGGG + Intergenic
1045217517 8:100163049-100163071 TATCACCTGACAACAAGGGAGGG + Intronic
1045336200 8:101205926-101205948 GATCACGTGGCTCCCAGGGCTGG - Intronic
1046868192 8:119174501-119174523 GATCACCTGAGCCCCAGGGAGGG - Intronic
1047139454 8:122120902-122120924 GATGTCCTGGACACCAAGGAAGG + Intergenic
1048203846 8:132400029-132400051 CGTAACCTGGCCACCAGGGAAGG + Intronic
1048503588 8:135000936-135000958 GCTCATCTTACCACCAGGGAGGG + Intergenic
1049262222 8:141645898-141645920 GGTCTCCGTGCCACCAGGGACGG - Intergenic
1049358222 8:142199188-142199210 TATCCTCTGGCCAGCAGGGAGGG - Intergenic
1049865054 8:144929843-144929865 GACCTGCTGGCCAGCAGGGAGGG + Intergenic
1051192555 9:14530737-14530759 GATGAGCTGACCACCAGGGCTGG + Intergenic
1051574395 9:18598552-18598574 GATCATCTGGCCACAAGGGAGGG - Intronic
1051943962 9:22543206-22543228 GAACACCTAGTCAACAGGGAAGG + Intergenic
1059418042 9:114174199-114174221 GATCTCCTGACCTCCAGGCAGGG + Intronic
1060624316 9:125096412-125096434 TATCACCTCCCCACCAGGGATGG + Intronic
1061929545 9:133825296-133825318 GAGCCTCGGGCCACCAGGGAGGG + Intronic
1062073178 9:134570098-134570120 GCTCACCTCTGCACCAGGGATGG - Intergenic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic
1188451344 X:30310374-30310396 GATCACCTGGACACTAGGAGGGG - Intergenic
1189249098 X:39586206-39586228 ATTCACCTGGCCACCAGCCACGG + Intergenic
1190781063 X:53595318-53595340 GATCTCCTGTCCGCCAGAGAAGG - Exonic
1192220626 X:69195274-69195296 GCACAGCTGGCCAGCAGGGAGGG - Intergenic
1192572433 X:72217653-72217675 TATCCCCTGGCCACTAGGGTGGG - Intronic
1195614239 X:106900301-106900323 GACTACATGGCCACCTGGGAAGG + Exonic
1199000532 X:142631345-142631367 GATCACTTGGACACAAGGCAGGG + Intergenic
1199697501 X:150353212-150353234 GGTCTCCTGGCTACCAGGGCAGG + Intergenic
1199789661 X:151140770-151140792 GATCACTTGGACACAAGGCAGGG - Intergenic
1200157381 X:153984482-153984504 GAGCACATTGCCACCAGGTAAGG + Intergenic
1201939831 Y:19447862-19447884 GATATCCTGACCACCAAGGAAGG - Intergenic
1202087364 Y:21153074-21153096 GGTCACCTGGCCTCCAGGTTTGG - Intergenic