ID: 1094375292

View in Genome Browser
Species Human (GRCh38)
Location 12:29783301-29783323
Sequence CCTCCTCTCCAGGATGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094375292_1094375301 -4 Left 1094375292 12:29783301-29783323 CCATGCACATCCTGGAGAGGAGG 0: 1
1: 0
2: 3
3: 30
4: 327
Right 1094375301 12:29783320-29783342 GAGGGAGGCGTGGAGGGAAAGGG 0: 1
1: 1
2: 6
3: 196
4: 1625
1094375292_1094375299 -10 Left 1094375292 12:29783301-29783323 CCATGCACATCCTGGAGAGGAGG 0: 1
1: 0
2: 3
3: 30
4: 327
Right 1094375299 12:29783314-29783336 GGAGAGGAGGGAGGCGTGGAGGG 0: 1
1: 0
2: 21
3: 331
4: 3139
1094375292_1094375302 -1 Left 1094375292 12:29783301-29783323 CCATGCACATCCTGGAGAGGAGG 0: 1
1: 0
2: 3
3: 30
4: 327
Right 1094375302 12:29783323-29783345 GGAGGCGTGGAGGGAAAGGGCGG 0: 1
1: 0
2: 15
3: 212
4: 1655
1094375292_1094375300 -5 Left 1094375292 12:29783301-29783323 CCATGCACATCCTGGAGAGGAGG 0: 1
1: 0
2: 3
3: 30
4: 327
Right 1094375300 12:29783319-29783341 GGAGGGAGGCGTGGAGGGAAAGG 0: 1
1: 0
2: 42
3: 1353
4: 4203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094375292 Original CRISPR CCTCCTCTCCAGGATGTGCA TGG (reversed) Intronic
900438579 1:2642625-2642647 CCTCCGCTCAAGAATCTGCAGGG + Intronic
900492676 1:2960245-2960267 CTTCCTCTCTAGGATGCTCAGGG + Intergenic
900765603 1:4503148-4503170 CCACTTCTCCATGATGTGCTGGG - Intergenic
902516018 1:16990034-16990056 CCAACTCTCCAGGGTGGGCAGGG - Intronic
903264723 1:22150910-22150932 CCTGCTGGCCAGGCTGTGCAGGG - Intergenic
903471314 1:23589348-23589370 CCATCTCTCCAGGATTAGCAAGG + Intronic
903767616 1:25744681-25744703 CCACCTCTCTAGGCTGGGCAAGG - Intronic
904078653 1:27858342-27858364 CCTCCTCTCAGGGCTGTGCCCGG - Intergenic
906543092 1:46603254-46603276 CCTACTGTCCAGCATGTGCCTGG + Intronic
906671458 1:47658268-47658290 CCCCCTCCCCAGCATGTGCCAGG + Intergenic
907167041 1:52421993-52422015 CCTGTTCTCCAAGATGTGGAAGG + Intronic
907317516 1:53581868-53581890 CCTCCTCCCTAGGGTGTGCCAGG + Intronic
907456262 1:54578021-54578043 CCCCCTACCCAGGCTGTGCAGGG + Intronic
907519763 1:55015506-55015528 GCTCTTCTCCGGGATGTGCAGGG - Intergenic
908267098 1:62390189-62390211 CCACCTTTCAAGAATGTGCAAGG - Intergenic
910049293 1:82956986-82957008 CCTCCTCCCCAGGCTGAGCTAGG + Intergenic
911521603 1:98936511-98936533 CCTGATCCTCAGGATGTGCATGG + Intronic
911579726 1:99620869-99620891 CCTCCTCTTCAGGAAATGCCAGG + Intergenic
912296393 1:108474631-108474653 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
913233699 1:116762839-116762861 CCTGCTCTCCAGTTTGTCCAGGG - Intronic
913451228 1:118993986-118994008 CCTCCTCTCCTTTATCTGCAAGG + Intergenic
914903908 1:151728507-151728529 CCTCCCCTCCACGCTGTGCCTGG - Intronic
915456342 1:156043360-156043382 CTTCATCTCCAGGATGAGGAAGG - Intronic
917764043 1:178198348-178198370 CATCCTCTCCAGCATCTGGAGGG + Intronic
920826950 1:209431400-209431422 CATCCTCCCCAAGATGTGCCTGG - Intergenic
922934738 1:229414064-229414086 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
923770822 1:236936285-236936307 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
1063946397 10:11180399-11180421 CCTCATCTGCAGGATGAACAGGG + Intronic
1064242821 10:13646485-13646507 CCTCCTCTTCATGAAGTGCTTGG + Exonic
1064885724 10:20110277-20110299 TCTTCTCTCCAGGATAGGCAAGG - Intronic
1067338903 10:45385188-45385210 CCTCATTTCCAGGTTGTTCAAGG - Intronic
1068560920 10:58513262-58513284 GCTCCACTCCGGGCTGTGCAGGG - Exonic
1069169954 10:65214478-65214500 CCTCCTGTCCTGAAAGTGCAAGG + Intergenic
1070158739 10:73852726-73852748 ACTCCTCTCCAGGATTCTCAGGG - Intronic
1070504823 10:77103878-77103900 CTTCCTCTCCATCATGAGCACGG + Intronic
1070806285 10:79272951-79272973 CATCCTCTCCAGCCTGTCCAGGG - Intronic
1070862310 10:79683131-79683153 CCTCCTCTCCACGCTGGGGATGG - Intergenic
1071619748 10:87108475-87108497 CCTCATCTCTAGGCTGGGCATGG - Intronic
1072321201 10:94251955-94251977 TCTCCCTTCCAGGATGTCCAAGG + Intronic
1072913406 10:99522711-99522733 GCTCTGCTCCAGGAAGTGCACGG + Intergenic
1073068501 10:100778727-100778749 CCTTCTCCCCAGGATGTACAGGG + Intronic
1074358695 10:112807910-112807932 CCTTCTTTCCAGGCTGGGCATGG + Intronic
1075289620 10:121217185-121217207 CCTCCACTCCAGGAAATGTAGGG - Intergenic
1075943374 10:126410282-126410304 AAGCCTCTCCAGGATTTGCAGGG - Intergenic
1076690191 10:132219794-132219816 CCTCCTCACCATGATGTGGGGGG - Intronic
1076718791 10:132383407-132383429 CCCCCTCTTCAGGTTGTGGACGG - Intergenic
1077393492 11:2310318-2310340 CCTGCTCTCCAGGAAGGGAAGGG + Intronic
1078707598 11:13760210-13760232 CCTCCTCTCCTCTATGGGCAGGG - Intergenic
1079107978 11:17586106-17586128 CCTCCTACCCAGGTTGTTCATGG - Intronic
1079341297 11:19613609-19613631 AATCCTCTCCAGGACTTGCAGGG + Intronic
1080282916 11:30579488-30579510 CCTCTGCTACAGGATGTGCTGGG - Intronic
1083068378 11:59949433-59949455 CCTTCCCTCCAGGATCTGCGGGG - Intergenic
1083420547 11:62550249-62550271 CCTCCCTCCCAGGGTGTGCAAGG - Intronic
1083839671 11:65297108-65297130 TCTCCTCCCCAGGATGTCCTCGG + Exonic
1084191072 11:67498987-67499009 CCTCGGCTCCAGGCTCTGCAGGG + Exonic
1084227061 11:67723217-67723239 CTTCCTCTCCAAGCTGTGCTGGG - Intergenic
1084420897 11:69060017-69060039 CCTCCTCTCCACGATGCCCATGG + Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085765282 11:79276811-79276833 CCTTCTCCCCAGGATGTGGGTGG - Intronic
1086125390 11:83344154-83344176 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1086462175 11:87016946-87016968 CCTCCTCTCTTGGAGGTGGAAGG - Intergenic
1086512992 11:87580251-87580273 TCTTCTCTCCAGGATCTGGATGG + Intergenic
1087684585 11:101248762-101248784 CATCCACTCCAGGATGAACAAGG - Intergenic
1088074650 11:105831981-105832003 CCTCCAATCCAGCATGTCCAAGG - Intronic
1090257753 11:125297821-125297843 TCTCCTCGCCAGGATGAGCCTGG + Intronic
1090511885 11:127384239-127384261 CGTCCTCTCAGGGCTGTGCAAGG - Intergenic
1090527850 11:127556708-127556730 TCTCTTCTCCATGATGTGCAGGG + Intergenic
1090544078 11:127743432-127743454 TCTCCTCTCGAGGCAGTGCAGGG + Intergenic
1090774430 11:129950588-129950610 CCTCCTCACCAGAACCTGCAAGG + Intronic
1091819634 12:3466074-3466096 CCTCCTCCACAGCAGGTGCAGGG - Intronic
1092416259 12:8292598-8292620 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1092533338 12:9363432-9363454 CCTCCTCCACAGCAGGTGCAGGG + Intergenic
1093024233 12:14232223-14232245 CCTCCTCCCCAGGCTGAGCCAGG + Intergenic
1093268093 12:17025730-17025752 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1094375292 12:29783301-29783323 CCTCCTCTCCAGGATGTGCATGG - Intronic
1094825675 12:34267307-34267329 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
1095637571 12:44451450-44451472 CCTCCTCTCCAGGCCGAGCTAGG + Intergenic
1096618152 12:52846282-52846304 CCTTGTCTCCAGGATGTGGATGG - Exonic
1097542280 12:60956042-60956064 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1098102696 12:67035311-67035333 CCCCCTCAGCAGGGTGTGCATGG + Intergenic
1098538866 12:71628692-71628714 GCTCCTCTCCAGTAAATGCAAGG - Intronic
1098961531 12:76744470-76744492 CCTCATCTGAAGGATTTGCAGGG - Intergenic
1099014554 12:77328562-77328584 CCACGTCTCAAAGATGTGCATGG - Intergenic
1100655134 12:96635982-96636004 CCTCCCCTCCAGGAGGTGGGAGG + Intronic
1103734403 12:123050087-123050109 CCTCCTCAAGAGCATGTGCAGGG + Intronic
1104879672 12:132061845-132061867 CGGCCTTTCCAGCATGTGCACGG + Intronic
1105887226 13:24652369-24652391 GCTCTCCTCCAAGATGTGCAGGG - Intergenic
1106394695 13:29368318-29368340 CATCCTCTCCAGGAAGTGCAAGG + Intronic
1110412152 13:75216081-75216103 ATTCCTCTCCAGGATGTTCAGGG + Intergenic
1110436976 13:75486233-75486255 CTTCCTCTCTATGATGGGCATGG - Intergenic
1112236744 13:97643987-97644009 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1112889407 13:104212118-104212140 CCTCCTCGCCAGGCTGAGCTGGG - Intergenic
1113541782 13:111115164-111115186 CCTCCGCTCCAGGCCGTGCGCGG - Intronic
1113608469 13:111626841-111626863 CCACCCCTCCCGGACGTGCAGGG + Intronic
1114557376 14:23569815-23569837 CCCCTGCTCCAGGCTGTGCAGGG - Intronic
1114666028 14:24377672-24377694 GCTCTTCTCCAGGAGGTGCAGGG - Exonic
1116573374 14:46545607-46545629 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1118292047 14:64535832-64535854 CCTGCTCTCCAGTATTTGCAAGG - Intergenic
1119265996 14:73263633-73263655 CCACCTCTCCAGGATTAGCTTGG + Exonic
1119645247 14:76343243-76343265 ACTCCTTGCCAGGATGTACAAGG - Intronic
1119932807 14:78564563-78564585 CCTCCTCTCTAGGAGGTATATGG + Intronic
1120539646 14:85737031-85737053 CCTCCTCTCCAGGCTGAGCTAGG - Intergenic
1120603176 14:86537870-86537892 TTTTCTCTCCAGGATTTGCATGG - Intergenic
1120780058 14:88479148-88479170 CTTGGGCTCCAGGATGTGCAGGG + Exonic
1120780324 14:88480524-88480546 CCTCATCTATAGGATGGGCATGG + Intronic
1121845669 14:97169990-97170012 CTTCCTCACCAGGCTCTGCAGGG - Intergenic
1122003519 14:98683870-98683892 CATCCTCTCCATGATCTTCACGG + Intergenic
1122272027 14:100572572-100572594 CCTCCCCTCCAGGAGGGGTAAGG - Intronic
1122825820 14:104369920-104369942 CCTCCTGGCCAGGATGTCGATGG - Intergenic
1122829657 14:104389605-104389627 CCTTCTCTCCAGGAAGGCCAGGG - Intergenic
1124021860 15:25932827-25932849 CCTCCACTGCAGGATGTGGTTGG + Intergenic
1126697625 15:51339747-51339769 CCTACTCTCCAGGGTGAGCCAGG - Intergenic
1129612393 15:77071030-77071052 CCTCCTCGCTAGGAACTGCACGG + Exonic
1130051510 15:80487480-80487502 TCTCAACTCCTGGATGTGCATGG - Intronic
1130228332 15:82076947-82076969 CCTCCTCTTAATGATTTGCAGGG - Intergenic
1130438322 15:83925172-83925194 GCCCATCTCCAGGATGTGGAGGG - Intronic
1130930878 15:88426798-88426820 CCTCCTAACCAGGATGAGCTAGG - Intergenic
1131421354 15:92308150-92308172 CCTTCTCTCGAGGGTGGGCAGGG + Intergenic
1131749619 15:95492664-95492686 CCTCCCTTTCAGGATGTGCTAGG - Intergenic
1132262930 15:100441937-100441959 CCTCCTCACCAGGCTGAGCTAGG + Intronic
1132327734 15:100985827-100985849 ACTCCTTTGCAGGAAGTGCAGGG - Intronic
1132635892 16:946405-946427 CCTCCTCTCTAGGACTTGCTGGG - Intronic
1133765820 16:8837044-8837066 CCTCCTCGCCAGGCTGAGCTAGG - Intronic
1134332936 16:13266766-13266788 CCTTCCCTCCTTGATGTGCAAGG - Intergenic
1135351260 16:21731070-21731092 GCTCCATTCCAGGATGTGCAAGG + Intronic
1135449740 16:22547196-22547218 GCTCCATTCCAGGATGTGCAAGG + Intergenic
1136098459 16:27975517-27975539 TGTCCTCTACAGGACGTGCAGGG + Intronic
1137567506 16:49542710-49542732 CCTCCTCCCCAGGGTGGGCTGGG - Intronic
1138555751 16:57770396-57770418 CCTCCTCTCCCCGATGGCCACGG - Intronic
1139847812 16:69933030-69933052 CCTCCTCTCCAGGCTCTGCTTGG + Intronic
1139943134 16:70620493-70620515 CCTCCTCGCCAGGCTGAGCTAGG - Intronic
1140536754 16:75716714-75716736 CCTCCTCTCCAGAAGTTGGAGGG + Intronic
1140681727 16:77391878-77391900 CCTTCTTTCCATGATGTGGATGG - Intronic
1141039046 16:80655784-80655806 CCTTCTCTCCAGGAGACGCAGGG + Intronic
1141444608 16:84049921-84049943 CATCCTCTCCAGGACCTCCAAGG + Intergenic
1141915077 16:87090259-87090281 CCTCCTCTTCAAAATGTGGATGG - Intronic
1142108963 16:88321142-88321164 CCTCCTGTCCAGGCTGTCCTGGG + Intergenic
1142614724 17:1127598-1127620 CCTCCTCTCCAGGAGGCTCCAGG + Intronic
1144533187 17:16060112-16060134 CCTCCCCTTCAGGATGAGGAAGG + Intronic
1145885401 17:28378924-28378946 CCTACTCTGTAGGATTTGCAGGG - Intronic
1146798563 17:35800321-35800343 CCTCCTCCCCAGGAAGTGTGTGG + Intronic
1147261321 17:39211049-39211071 GCTTCTCTCCAGGCTCTGCAGGG - Exonic
1147664223 17:42135859-42135881 CTTGCTCTCCAGGCTGTGCCAGG - Intronic
1148062502 17:44846466-44846488 CCTCCTCTCCTGGAGGAGCAAGG - Intronic
1148555099 17:48573951-48573973 CCGTCTCTCCCGGATCTGCAAGG - Intronic
1149582653 17:57762122-57762144 CCTCCCCTGCAGGCTGGGCAGGG - Intergenic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1152331948 17:79678586-79678608 CCGCCTCCCCGGGCTGTGCAGGG + Intergenic
1152700003 17:81814009-81814031 CCTGCTTTCCAGGACATGCACGG - Exonic
1152701081 17:81820023-81820045 CCTCCTGCCCAGCATGTGCCTGG + Intergenic
1153020185 18:621822-621844 CCTCCTTGCCAGGAGGTTCAGGG - Intronic
1154021952 18:10671148-10671170 GCATCTCTCCAGGAAGTGCACGG + Intronic
1156392121 18:36660308-36660330 CCTCTTCCCCAGGATGTTCAAGG - Intronic
1156425196 18:37003448-37003470 ACTCATATCCAGGATGTTCAAGG + Intronic
1156927096 18:42595705-42595727 CCACCTCTCTAGCATGTTCAGGG + Intergenic
1159025286 18:63177874-63177896 CCGCATCTCCAGAAAGTGCAGGG + Intronic
1160060800 18:75527203-75527225 CCTCCTTTTCAGGGGGTGCAGGG - Intergenic
1161320355 19:3638092-3638114 CCTCCTTCCCAGGGGGTGCAGGG + Intronic
1161427596 19:4212491-4212513 CTGTCTCTCCAGGATGTGCAGGG - Exonic
1163187879 19:15652557-15652579 CCTTCTCTCCAGGATGAAGATGG + Exonic
1163189795 19:15669436-15669458 CCTTCTCTCCAGGATGAAGATGG + Intergenic
1163217017 19:15886298-15886320 CCTTCTCTCCAGGATGAAGACGG - Exonic
1163221200 19:15922420-15922442 CCTTCTCTCCAGGATGAAGATGG - Exonic
1163380035 19:16959980-16960002 CCTCCTCTCCTGGATGCAGAAGG + Intronic
1163722947 19:18906886-18906908 CCACATCTCCAGGCTGCGCACGG - Intronic
1163771537 19:19194015-19194037 CCTCCTCTCCGGGGTCTTCAGGG - Exonic
1164459313 19:28433918-28433940 CCTCCTCTCCAGGCTGAGCTAGG - Intergenic
1164575739 19:29404418-29404440 CCTCCTCCCCGGCATGTCCATGG - Intergenic
1165317103 19:35063123-35063145 CCTCCTTACCAGGGTGTGCTGGG - Intronic
1165359593 19:35327913-35327935 CTTCATCTGTAGGATGTGCATGG + Intronic
1165427856 19:35755673-35755695 CCTCCCCTCCAGGATGAGCACGG - Exonic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1167360027 19:49025052-49025074 CCCACTCCCCAGGATGAGCAAGG + Intronic
1167361056 19:49030719-49030741 CCCACTCCCCAGGATGAGCAAGG - Intronic
1167362593 19:49038078-49038100 CCCACTCCCCAGGATGAGCAAGG + Intergenic
1167364959 19:49049820-49049842 CCCACTCCCCAGGATGAGCAAGG + Intergenic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
1168228069 19:55010806-55010828 CCTCCTCCCCAGGCTGAGCTAGG - Intergenic
1168276433 19:55280967-55280989 CCTCCTATCCAGGATCAACACGG - Intergenic
925876699 2:8317378-8317400 GCTCCTCTACAGGATGCCCAGGG - Intergenic
926107315 2:10160496-10160518 CCTCCTCTCCCTGGTCTGCATGG - Intronic
926148959 2:10414010-10414032 CCTCCTCCCCAGGCCTTGCATGG - Intronic
926464172 2:13168017-13168039 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
931881256 2:66573878-66573900 CCTCCTCTCCAGTACATGCCCGG + Intergenic
932368560 2:71169066-71169088 CATTCTCTCCAGGATCAGCAAGG - Intergenic
933079193 2:77966790-77966812 CCTCCTCGCCAGGCTGAGCCAGG + Intergenic
933811470 2:86035401-86035423 CCTCCTCTCCAGTCTGTGGCAGG - Intronic
933990815 2:87632764-87632786 TCTCCTCTCCGGGAAGTGGAGGG + Intergenic
936303027 2:111318059-111318081 TCTCCTCTCCGGGAAGTGGAGGG - Intergenic
936794381 2:116188293-116188315 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
939623482 2:144448641-144448663 CCCCCTCTCCAGATTTTGCATGG - Intronic
942097000 2:172543393-172543415 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
942367922 2:175248478-175248500 CCACCTCTACAGGATCTCCATGG - Intergenic
942539442 2:177000448-177000470 CCTTCTATCCATAATGTGCAAGG + Intergenic
942801115 2:179877035-179877057 CCTCCTCTCGAAGATGTGGTAGG + Intergenic
945361560 2:208900902-208900924 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
947147805 2:227084839-227084861 ACTCCTCTCCGGGCTGGGCACGG + Intronic
948164530 2:235850995-235851017 CCCCCTCTGTAGGTTGTGCAGGG - Intronic
1169475780 20:5930050-5930072 CCTCCTCTACAGGCTTTGAAGGG - Intergenic
1170522884 20:17206476-17206498 ACTCCTCTCCACTATGTGGATGG - Intergenic
1171296860 20:24024731-24024753 CCTTCTTTCCAGGATGTGAAGGG + Intergenic
1172563423 20:35909359-35909381 CCTCCTCCCTAGAATGTGCCTGG + Intronic
1173877770 20:46386201-46386223 CATGCTCTCCAGGATGGCCAGGG + Exonic
1174224268 20:48984263-48984285 CCTCCTCTCCAGAATGTTTGTGG - Intronic
1174467466 20:50729291-50729313 CCTCCTCTCCCTGATTGGCAAGG - Intergenic
1174804756 20:53594700-53594722 CCTCCTCTGCAAGGTGTGCGCGG + Intronic
1175240940 20:57548312-57548334 TCTGGTCTCCAGGATCTGCACGG + Intergenic
1175938695 20:62527210-62527232 CCCCCTGCCCAGCATGTGCACGG + Intergenic
1176515425 21:7780301-7780323 CCGCCTCTCCAGGTTCTGCATGG - Intergenic
1176733285 21:10521200-10521222 CCTCCTCTGCAAGGTGTGCCTGG - Intergenic
1177102596 21:16915642-16915664 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
1178007901 21:28243541-28243563 CCCCCTCCTCAGCATGTGCAGGG + Intergenic
1178649453 21:34410313-34410335 CCGCCTCTCCAGGTTCTGCATGG - Intergenic
1178805302 21:35834326-35834348 CCTCCTGGCCAGGATGTGAAGGG + Intronic
1179015373 21:37591074-37591096 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1179559890 21:42208939-42208961 CCTCCTCTCCAGGAGGGCCTGGG - Intronic
1179594209 21:42431191-42431213 CCTTCTCCCCATGCTGTGCAGGG - Intronic
1180103210 21:45599547-45599569 CCTCCTCCCCAGGCTGTCCCAGG - Intergenic
1180193669 21:46181358-46181380 GCACCTCGCCAGGATGTGCGGGG - Intronic
1180702389 22:17788715-17788737 CGTTATCTCCCGGATGTGCATGG + Exonic
1181256713 22:21567663-21567685 CCCCCGCTCCAGGAAGTGCGGGG + Intronic
1181267163 22:21637073-21637095 CCTCCTCTCCAGGCTCTGGGAGG - Exonic
1181471920 22:23145794-23145816 ACTCCTCTCCAGGCTGGGCTGGG - Intronic
1181690585 22:24557030-24557052 CCTGCTCTCCTAGATGTGCATGG + Intronic
1182044011 22:27260263-27260285 CCTCCCCTCCAGAATGCCCAAGG + Intergenic
1182071144 22:27464602-27464624 CCTCCTGTCTGGGATGTGAATGG - Intergenic
1183130219 22:35827297-35827319 CCTCTTCTGCAAGATTTGCAAGG + Intronic
1183343233 22:37293668-37293690 CTTTCTCCCCAGGATCTGCAGGG - Intronic
1183535728 22:38399245-38399267 CCTCCTCTGCAAGGTGTGCCCGG + Intergenic
1183586412 22:38755637-38755659 CCTCCTCTCCGGGACGTGCTGGG - Intronic
1183764075 22:39854119-39854141 CCACTTCCCAAGGATGTGCACGG - Intronic
1184499040 22:44860846-44860868 CCTTCGCCCCAGGCTGTGCAGGG + Intronic
1184880995 22:47304173-47304195 CCACCCCTCCAGGATCAGCAAGG + Intergenic
1185251743 22:49805600-49805622 CCTCCTCTGCAGGCTGGGCTGGG + Intronic
954135553 3:48580589-48580611 CATCCTCTCCAGGATCTCCCTGG + Exonic
954808636 3:53234567-53234589 CCTCCTCCCCAGGCTGGGCGGGG + Intronic
955805358 3:62728296-62728318 CCTCCTCTCGAACATCTGCAGGG + Intronic
956485655 3:69719507-69719529 CCTTCTCTCCGGGATCTGCGGGG + Intergenic
956549073 3:70438919-70438941 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
956660345 3:71591280-71591302 CTTCCTCCCCAGGATGTTTAGGG - Intergenic
956733470 3:72217791-72217813 CCTCCTCCCCAGCATTTGCCTGG + Intergenic
957387438 3:79515102-79515124 ACTCCTCTCCAGGCTGTGTTTGG - Intronic
959888361 3:111527600-111527622 CCTCTTCTCCTGGTTGAGCAGGG - Intronic
959919662 3:111857027-111857049 CCTCCTCCCAAGTATCTGCATGG - Intronic
962302398 3:134253890-134253912 CTTCCTCTTCAGGATGGGCTGGG - Intergenic
962400968 3:135058390-135058412 CCTCCTCCCCAGGATGTACAGGG - Intronic
962660543 3:137597128-137597150 CCTCCTCGCCAGGTTGAGCTAGG + Intergenic
962732109 3:138293035-138293057 CCTCCCCTCCAGGCTTTGCCAGG + Intronic
963533675 3:146501766-146501788 CCTCCCCTCCAGATTATGCAGGG - Intergenic
964300335 3:155279238-155279260 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
965336240 3:167432869-167432891 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
966232933 3:177669875-177669897 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
966911373 3:184562096-184562118 CCTCCTCTCCTGGATCTCCTGGG + Exonic
966980966 3:185134912-185134934 CCTCATCTCCAGGGTGTCCGTGG + Intronic
967448816 3:189598742-189598764 CCTGCAGTCCAGGATATGCAAGG + Intergenic
968688482 4:1977116-1977138 GCCCCTGTCCTGGATGTGCAGGG + Intronic
968880563 4:3296713-3296735 CCTCTTCTCTGGGATGGGCAGGG + Intronic
969003898 4:4004271-4004293 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
969697915 4:8745655-8745677 TCTTTTTTCCAGGATGTGCACGG - Intergenic
969720458 4:8890641-8890663 CCTCCTCTCCAGTCTCTGCCTGG + Intergenic
969810029 4:9640553-9640575 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
970824393 4:20254112-20254134 GCTCAACCCCAGGATGTGCATGG - Intronic
971326918 4:25652271-25652293 CCTCCTCTCCAGGCCCTGCCTGG + Intergenic
975199610 4:71570977-71570999 CCTCCTCTCTTGGAGGTGGAAGG - Exonic
977664707 4:99632610-99632632 ACTGCTCTTCAGGATGTCCAAGG + Intergenic
978413177 4:108447125-108447147 CTTGTTCACCAGGATGTGCATGG - Intergenic
978632846 4:110767192-110767214 CCTCCTCTCTCAGATGTGCTTGG + Intergenic
979531067 4:121769647-121769669 CCTCATCTCCAGCACATGCATGG - Intergenic
980284864 4:130769012-130769034 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
980472528 4:133267751-133267773 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
980611862 4:135171324-135171346 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
981322747 4:143411546-143411568 CCTGCTCTGCAGGATTGGCAAGG + Intronic
981561178 4:146050088-146050110 CCTCTTCACTAGGAGGTGCAGGG - Intergenic
982726818 4:158915327-158915349 CCTCATGTCCTGGATATGCAAGG - Exonic
985435639 4:189927499-189927521 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
986343289 5:6811165-6811187 CCTCCTCTCCAGCAAAGGCAGGG + Intergenic
986928810 5:12794145-12794167 CCTACTCTCCTGGAGGGGCAGGG + Intergenic
992382783 5:76255423-76255445 CCTCCACCCCAGAATGTCCATGG + Intronic
994671864 5:102771648-102771670 CCTCCTCTCAAGAATTTGAAAGG - Intronic
996332127 5:122341786-122341808 CCTCCTATCCAACATTTGCAGGG - Intronic
997467968 5:134100773-134100795 CCTCCCATCCAGGATGGGCAGGG + Intergenic
997750655 5:136342280-136342302 CCAGCTCTCCAGGATGGGCTTGG - Intronic
998134366 5:139666994-139667016 CCTCACCTCCAGGATTTCCAGGG + Intronic
998169085 5:139861693-139861715 ACTCCTCTCCAGGGTGTCCCAGG + Intronic
998509285 5:142697936-142697958 CTTCCTCTCCAGGATCCCCAAGG - Exonic
998693792 5:144615412-144615434 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
999544562 5:152613020-152613042 ACTCCTCTCCATGATGTGTGGGG + Intergenic
1000438502 5:161241620-161241642 CCTCCTTTCCAGGCTGAGCTAGG + Intergenic
1001036959 5:168303838-168303860 CTTCAACTCCAGGAAGTGCAGGG + Intronic
1001303753 5:170556517-170556539 TCTCCTCTCCAGGAGGTGGGGGG + Intronic
1002349056 5:178569992-178570014 CCTCCTCTCCAGTATGGAGAGGG - Intronic
1002535077 5:179871739-179871761 GCTCCTTTCCAGGATGGGCGTGG + Intronic
1005503788 6:26452324-26452346 CCTCAGCTCCAGGGTGGGCAGGG - Exonic
1005672989 6:28125755-28125777 CCTCCTCTCCAGTCTCTGGATGG - Exonic
1005808334 6:29495920-29495942 CCTCTTCTCCAAGATGGGCAGGG + Intergenic
1006377066 6:33677496-33677518 CAGCCTTTCCAGGATCTGCAGGG - Exonic
1007432616 6:41785537-41785559 CCTCCCCTCCAGGCTGTACCTGG - Exonic
1007515419 6:42406767-42406789 CCTCCTCCCCAGCCTTTGCAGGG + Intronic
1010894623 6:81349145-81349167 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1012627821 6:101425865-101425887 TTTCCTCTCCAGGATTTGAAGGG + Intronic
1015271286 6:131340552-131340574 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1016980544 6:149850013-149850035 CCTGCTCTCCACCATCTGCACGG - Intronic
1016984970 6:149888311-149888333 TCTCCTCTCGAGGAGGGGCAAGG - Intronic
1017772206 6:157652072-157652094 CCTCCTCTGCAGGATGTCAAAGG - Intronic
1019124816 6:169831094-169831116 CCTCCTCCCGAGGGTGGGCAGGG - Intergenic
1020315962 7:6905467-6905489 GCTCCTCGCCAGGATGAGCTAGG + Intergenic
1021843467 7:24742093-24742115 CCTGCTCTCCTGGAGGTGCCTGG - Intronic
1023104031 7:36746437-36746459 CTTCCTGTGCATGATGTGCAGGG - Intergenic
1023573826 7:41603271-41603293 CCTTCTCTCCAGAAATTGCATGG + Intergenic
1023610482 7:41966220-41966242 CATCCTCTCCATGTTGGGCAGGG + Exonic
1024439413 7:49398643-49398665 CCTCCTCTCAAGATTGGGCAGGG + Intergenic
1029207282 7:98877613-98877635 CCTCCCCTCCAGGGTATCCACGG + Intergenic
1029435609 7:100562493-100562515 CCTGCTCTCCAGGGTGAGTAAGG - Intronic
1029812303 7:103061548-103061570 CCTCCTCTCCTAAATGGGCAGGG + Intronic
1030099419 7:105932411-105932433 CCTCCTCTCCTGTCTGTGCATGG + Intronic
1032468166 7:132159729-132159751 CATCCTCTCCAGGATGGGCTAGG + Intronic
1035192792 7:157186910-157186932 CCTCCACACCAGGTTGAGCAGGG - Exonic
1035637872 8:1160757-1160779 CTTCCTCGCCAGGCTTTGCATGG - Intergenic
1036905306 8:12703806-12703828 CTTCCTCTCCAGCCTGTGCTGGG - Intergenic
1037689520 8:21170546-21170568 TCCCCTCTGCAGGATGTGAACGG + Intergenic
1038647348 8:29372873-29372895 CCTCCTCCCCGGGATTTCCATGG - Intergenic
1043717985 8:83509176-83509198 CCTCCTCACCAGGCTGAGCTAGG - Intergenic
1043837638 8:85064607-85064629 CCTCCTCTCCAGGCCGAGCCAGG + Intergenic
1044537664 8:93375778-93375800 CCTACTCTCCAGAATATGCCTGG + Intergenic
1044738803 8:95304769-95304791 CCTTCTCTTCAGGATTTGGAAGG - Intergenic
1046624249 8:116560229-116560251 CCTCATCACCAAGATGTGCCTGG - Intergenic
1048135381 8:131742376-131742398 CCTCCTCACCAGGCTGAGCTAGG + Intergenic
1048866335 8:138764374-138764396 CCTACTGCCCAGGATGGGCAGGG + Intronic
1048985940 8:139734948-139734970 CCTACACTTCTGGATGTGCAGGG + Intronic
1050740354 9:8812703-8812725 CCTCCTCTCCAGAGTTTGTAAGG - Intronic
1051909246 9:22134138-22134160 CCTCCTACCCAGGATGGGGAAGG + Intergenic
1051953490 9:22662581-22662603 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1052162998 9:25289350-25289372 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1052720730 9:32168587-32168609 CCTCCTCGCCAGGCTGAGCCAGG - Intergenic
1054951678 9:70858911-70858933 CTGCCTCTCCAGGATGGGGAAGG + Intronic
1055347807 9:75355840-75355862 CCTCCTCGCCAGGCTGAGCTAGG - Intergenic
1056137319 9:83642986-83643008 GGTCCTCTGCAGGATGTTCAGGG - Intronic
1056721685 9:89077450-89077472 CCAGCTCTCCAGGTTGGGCAGGG - Intronic
1057552448 9:96061884-96061906 CCTGCCTTCCAGGATGTGCTTGG + Intergenic
1057911746 9:99024951-99024973 CATCCTCTCCAGGAGATCCAGGG - Exonic
1057962658 9:99471321-99471343 CCTCCTCCCCAAGCTGTGCCTGG - Intergenic
1058103125 9:100938321-100938343 CCTCCTCTCCAGGAAAGGCTCGG - Intergenic
1058836294 9:108861138-108861160 CTTCCTCCCCAGGATGTGCTGGG - Intergenic
1060743471 9:126114496-126114518 CCCACAGTCCAGGATGTGCATGG + Intergenic
1060804498 9:126565940-126565962 CCTCCTTCCCTGGATGTGCTGGG - Intergenic
1062309884 9:135929937-135929959 CCTTCTCTCCAGCCTGTGCTGGG + Intergenic
1187134771 X:16536869-16536891 CCTCCTCTCCTGTCTGTACAAGG + Intergenic
1187607900 X:20906147-20906169 CCCCTTCTCCAGGATTTGCTGGG + Intergenic
1188419396 X:29976937-29976959 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1188430938 X:30105004-30105026 CCTCCTCGCCAGGCTGAGCTAGG + Intergenic
1189510324 X:41655576-41655598 CATCCTCTCCGGGAAGTGCAAGG + Intronic
1190260912 X:48796234-48796256 GTTCCTGTCCAGGGTGTGCAGGG - Intergenic
1190708285 X:53048510-53048532 CCCCCTCTCCTCGATTTGCACGG - Intergenic
1193113841 X:77756605-77756627 TCGCCTCTCCCGGAAGTGCAAGG - Intronic
1194308620 X:92277077-92277099 CCTCCTCGCCAGGCTGAGCTAGG - Intronic
1198497789 X:137210650-137210672 CCTCTTGTCCAGGATGCACAGGG + Intergenic
1199935241 X:152567139-152567161 ACTCCTCTTTAGGATTTGCAAGG - Intergenic
1200047254 X:153409466-153409488 CATCCTCTCTAGGTTGGGCATGG + Intergenic
1200118642 X:153780366-153780388 CTTCCTCTCCACCATTTGCAAGG - Intronic
1202368488 Y:24182567-24182589 CCTTCTGTCCAGTATGTGCATGG - Intergenic
1202502297 Y:25487550-25487572 CCTTCTGTCCAGTACGTGCATGG + Intergenic