ID: 1094375325

View in Genome Browser
Species Human (GRCh38)
Location 12:29783420-29783442
Sequence GCGGCGGCTAGCGCGAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094375309_1094375325 24 Left 1094375309 12:29783373-29783395 CCGCAACTTCTCCCGGTCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1094375325 12:29783420-29783442 GCGGCGGCTAGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 89
1094375319_1094375325 7 Left 1094375319 12:29783390-29783412 CCGAGGGACGGGCGGAGGGTAGA 0: 1
1: 0
2: 2
3: 14
4: 156
Right 1094375325 12:29783420-29783442 GCGGCGGCTAGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 89
1094375308_1094375325 25 Left 1094375308 12:29783372-29783394 CCCGCAACTTCTCCCGGTCCGAG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1094375325 12:29783420-29783442 GCGGCGGCTAGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 89
1094375316_1094375325 12 Left 1094375316 12:29783385-29783407 CCGGTCCGAGGGACGGGCGGAGG 0: 1
1: 0
2: 1
3: 8
4: 87
Right 1094375325 12:29783420-29783442 GCGGCGGCTAGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 89
1094375315_1094375325 13 Left 1094375315 12:29783384-29783406 CCCGGTCCGAGGGACGGGCGGAG 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1094375325 12:29783420-29783442 GCGGCGGCTAGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094375325 Original CRISPR GCGGCGGCTAGCGCGAGGTG AGG Intronic
900566068 1:3332423-3332445 GGGGCGGCTAGGGAGCGGTGGGG + Intronic
900786751 1:4654585-4654607 GCGGGGGCGAGCGCGCGGAGAGG + Intergenic
902585833 1:17438302-17438324 GCGGGGGCAAGCGCGCGGCGCGG - Exonic
902779682 1:18696748-18696770 GGGGCGGGTAGTGGGAGGTGAGG + Intronic
903318522 1:22527375-22527397 GTGGCGGCCTGCGGGAGGTGAGG - Exonic
904623477 1:31789304-31789326 GCGGGGGGTGGGGCGAGGTGCGG - Intergenic
904822733 1:33256192-33256214 GCGACGGCGAGCGCGAGACGAGG + Intergenic
905685026 1:39901802-39901824 CGGGCGGCTGGAGCGAGGTGAGG - Exonic
909585215 1:77281861-77281883 GCGCGGGCTGGCGCGAGGTGCGG - Intergenic
916393248 1:164356684-164356706 GAGGCAGCTAGCGCGAGGCTGGG + Intergenic
917951237 1:180039110-180039132 GCGGCGGGTTGGGCGTGGTGGGG + Intronic
921127508 1:212190393-212190415 GCTGCGGCTGGCGGGAGGCGCGG - Intergenic
923506430 1:234609698-234609720 GGGGCGGCGGGCGCGAGGTGAGG + Intergenic
1071966571 10:90858043-90858065 GCGGCGGCGGGCGCGAGGGGCGG - Intergenic
1081636700 11:44726796-44726818 GCGGAGGCTGGCGGGAGGCGAGG + Intronic
1084285573 11:68128526-68128548 GCGGGGCCTCGCGCGAGGGGCGG + Intergenic
1088868952 11:113875413-113875435 GCGGCGGCGAGCGGGAGCTGGGG - Intronic
1094375325 12:29783420-29783442 GCGGCGGCTAGCGCGAGGTGAGG + Intronic
1095225353 12:39671963-39671985 GTGGGGGCTAGTGCTAGGTGAGG + Intronic
1096498335 12:52051290-52051312 GAGGCGGCCAGGGGGAGGTGCGG - Intronic
1106447660 13:29850641-29850663 GCGGCGGCTGCTGCGAGGGGGGG - Exonic
1110190894 13:72727707-72727729 CCGGCGGCGAGCGCGAGGGGCGG - Intergenic
1112504919 13:99969825-99969847 GCGGCGGCTGGCGCGCGTTGCGG + Intronic
1117424467 14:55580390-55580412 GCGGCGGGGAGCGCGGGGGGAGG + Intronic
1119378836 14:74215771-74215793 GGGGCGGCTAGGGTGGGGTGAGG - Intergenic
1122263874 14:100537882-100537904 GCGGGGGCTGGGGAGAGGTGAGG + Exonic
1123019027 14:105388991-105389013 CCGGCAGCTAGGGTGAGGTGAGG - Intronic
1124212780 15:27776956-27776978 GCGGCGGGGAGCGTGAGGTGGGG + Intronic
1124340188 15:28885599-28885621 GCGGCGGCCGGGGCAAGGTGCGG + Intronic
1127833287 15:62769632-62769654 GGGGTGGCTAGGGCAAGGTGAGG - Intronic
1128099925 15:64990025-64990047 GCTGCGGCTGGCGTGAGGAGAGG + Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1131160561 15:90102285-90102307 GCGGCTGCTCTTGCGAGGTGGGG + Exonic
1132552993 16:560885-560907 GGTGCGGCGAGCGCGAGGTCAGG - Intronic
1136932432 16:34431695-34431717 GGGGCGGGTAGAGGGAGGTGTGG - Intergenic
1136972140 16:34980119-34980141 GGGGCGGGTAGAGGGAGGTGTGG + Intergenic
1141608542 16:85169140-85169162 GCGGCGGCGGGCGGGAGGGGCGG - Intergenic
1142356820 16:89605273-89605295 GCGGTGGCTGGGGCGAGGTCTGG - Intergenic
1142855036 17:2724485-2724507 GAGGCGGCTGGCGCGGGCTGCGG + Intergenic
1144695815 17:17303397-17303419 GGGGCGGGGAGCGCGGGGTGCGG - Exonic
1146054106 17:29572735-29572757 GCGGCGGGCGACGCGAGGTGGGG - Intronic
1148777957 17:50106086-50106108 GCGGCGGGGAGCGGGCGGTGGGG + Intronic
1149614748 17:57988282-57988304 GCGGCGGCGAGCGCGGGCGGGGG + Intergenic
1152388850 17:79991353-79991375 GCTGAGGCTGACGCGAGGTGGGG + Intronic
1152687820 17:81703337-81703359 GACGAGGCTAGCGCGAGGTACGG + Exonic
1160745373 19:708926-708948 GCGGCGGCGGGCGCGGGGGGTGG - Intergenic
1162514278 19:11138778-11138800 GCGGCTGCCAGAGGGAGGTGGGG + Intronic
1163427130 19:17245852-17245874 GCGGCGGCGAGAGCGAGGCTTGG - Exonic
1164393329 19:27844057-27844079 GAGGCGGCTAGCGGGTGCTGGGG + Intergenic
1165695060 19:37894727-37894749 TCGGCGGCTAGAGCTTGGTGAGG - Exonic
1167295514 19:48646742-48646764 GAGGCGGAGAGCGGGAGGTGAGG + Intergenic
1168575630 19:57506223-57506245 GAGGGGGCTAGCGCTTGGTGGGG - Intronic
1168682663 19:58327190-58327212 GGGGCGGCCAGAGCGAGATGCGG + Intronic
924988093 2:288850-288872 GGGGAGGCGAGAGCGAGGTGAGG - Intronic
929604278 2:43224936-43224958 GCGGCGGCGTGCGCGACGTGGGG + Exonic
930096441 2:47570287-47570309 GCGGCGGCTACGGCGGGGCGGGG + Exonic
932820703 2:74897493-74897515 GCGGCGGGGAGGGGGAGGTGGGG - Intergenic
1171123626 20:22584589-22584611 GCGGCGGGAAGCGCGCGGCGCGG + Intronic
1175870291 20:62206151-62206173 ACGGCGGCTAACGTGAAGTGTGG - Intergenic
1175922798 20:62457989-62458011 GCAGCGGCATGCCCGAGGTGGGG + Intergenic
1179529581 21:42009747-42009769 GCGGCGGGTCGCGGCAGGTGCGG + Intronic
1179674832 21:42974441-42974463 GCGGCGGCGGGCGCGGGGCGGGG - Intergenic
1181017696 22:20080538-20080560 GCGGTGGAGAGCGCGGGGTGGGG + Intronic
1182547672 22:31085270-31085292 TCGGCGCCTAGCGCGAGGCAGGG + Intronic
1183447641 22:37869194-37869216 GCGGAGGCTACAGTGAGGTGAGG - Intronic
1184412242 22:44331918-44331940 GCGGCGGCGAGCGCGGGGCCCGG - Intergenic
1184759860 22:46537899-46537921 GCGGCCCCGAGCCCGAGGTGCGG - Intergenic
954401352 3:50321360-50321382 GTGGCGCCCCGCGCGAGGTGAGG - Exonic
955911601 3:63864020-63864042 GCCGCGGCCGGCGCGAGTTGGGG + Intergenic
961514963 3:127426611-127426633 GGTGGGGCTAGCACGAGGTGGGG + Intergenic
961691293 3:128671796-128671818 CCGGGGGCTAAAGCGAGGTGAGG - Intronic
962788957 3:138793376-138793398 GGGGCGGATCCCGCGAGGTGAGG + Intronic
964323621 3:155523532-155523554 GGGGCTGCTAGCACGAGGTAGGG + Intronic
968081096 3:195847500-195847522 GCTGGGGCTGGCGCTAGGTGCGG + Intergenic
968674721 4:1871360-1871382 GCGGCGGCGGGCGGGAGGCGCGG + Intergenic
977581393 4:98729000-98729022 GCAGGGGCTAGCATGAGGTGGGG - Intergenic
985551401 5:535233-535255 GCGGGGGCAAGGGTGAGGTGAGG - Intergenic
998130369 5:139648666-139648688 GCCGCGGCTGGCCCGAGGCGGGG - Exonic
1001563361 5:172684221-172684243 GCAGCGCCTAGCGAGAGGGGCGG - Intronic
1004140642 6:13014165-13014187 GCGGCGGCGAGCGCGGGAGGCGG + Intronic
1005931443 6:30487895-30487917 GAGGCGGCTAGTGAGGGGTGAGG + Intergenic
1012530438 6:100229172-100229194 GCGGCGGCGAGGCCGAGGCGGGG - Intergenic
1016738552 6:147506825-147506847 GCGGCGGCCCGCGCGGGGCGGGG + Intergenic
1019473275 7:1232527-1232549 GCGGCGGCTGGCGGGAGGCGCGG + Intergenic
1019544973 7:1569878-1569900 GCGGCGGCGAGGCCGAGGGGCGG - Exonic
1019689671 7:2403629-2403651 GCGGCTGCGGGCGCGAGGTGAGG + Exonic
1027001411 7:74657314-74657336 ACGGCGGCTGGCGCTCGGTGGGG + Intergenic
1027374517 7:77537124-77537146 GCGGCTGCTGGCGGGGGGTGGGG + Intergenic
1036561437 8:9903284-9903306 GCGGCCGCGGGCGCGAGGGGAGG - Intergenic
1048608967 8:136001237-136001259 GCAGCGGCTATGGCGGGGTGGGG - Intergenic
1049752365 8:144291372-144291394 GTGGCGGCCGGCGCGCGGTGGGG - Intergenic
1053067445 9:35078599-35078621 GCGGAGCCTAGAGAGAGGTGAGG - Exonic
1056992358 9:91423752-91423774 GCGGCGGCGAGGGCGCGGCGCGG + Exonic
1060477936 9:123999657-123999679 GCGGCGGCGAGCGCCGGGAGGGG - Intergenic
1185747618 X:2584646-2584668 GCGGGGGCGAGCGCGCGGGGAGG + Intergenic
1190730836 X:53224643-53224665 GCGGAGGGCAGCTCGAGGTGGGG - Intronic
1192260617 X:69504267-69504289 GCGGGGGCTGGGGCGGGGTGGGG + Intergenic
1195380966 X:104270478-104270500 GAGGCGGGAAGCGGGAGGTGGGG - Intergenic
1199772372 X:150983300-150983322 GAGGCAGCTAGCGCGAGGCTGGG + Exonic
1200128939 X:153830723-153830745 GCGGCGCCGAGCGCGAGGGCCGG - Intergenic