ID: 1094383521

View in Genome Browser
Species Human (GRCh38)
Location 12:29869053-29869075
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094383514_1094383521 9 Left 1094383514 12:29869021-29869043 CCAGAGACGCAAGAGCACAGTCA No data
Right 1094383521 12:29869053-29869075 TGGACTTCTACACCTGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094383521 Original CRISPR TGGACTTCTACACCTGGGGT TGG Intergenic
No off target data available for this crispr