ID: 1094386443

View in Genome Browser
Species Human (GRCh38)
Location 12:29899418-29899440
Sequence CCTATTCCACCCCTATTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094386443_1094386451 21 Left 1094386443 12:29899418-29899440 CCAGGAAATAGGGGTGGAATAGG No data
Right 1094386451 12:29899462-29899484 TCTAGGAAGCAGATTCTCATGGG No data
1094386443_1094386447 -3 Left 1094386443 12:29899418-29899440 CCAGGAAATAGGGGTGGAATAGG No data
Right 1094386447 12:29899438-29899460 AGGGAGGTTTTCCTAAATGTAGG No data
1094386443_1094386448 4 Left 1094386443 12:29899418-29899440 CCAGGAAATAGGGGTGGAATAGG No data
Right 1094386448 12:29899445-29899467 TTTTCCTAAATGTAGGTTCTAGG No data
1094386443_1094386450 20 Left 1094386443 12:29899418-29899440 CCAGGAAATAGGGGTGGAATAGG No data
Right 1094386450 12:29899461-29899483 TTCTAGGAAGCAGATTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094386443 Original CRISPR CCTATTCCACCCCTATTTCC TGG (reversed) Intergenic
No off target data available for this crispr