ID: 1094386449

View in Genome Browser
Species Human (GRCh38)
Location 12:29899449-29899471
Sequence GCTTCCTAGAACCTACATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094386449_1094386451 -10 Left 1094386449 12:29899449-29899471 CCTAAATGTAGGTTCTAGGAAGC No data
Right 1094386451 12:29899462-29899484 TCTAGGAAGCAGATTCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094386449 Original CRISPR GCTTCCTAGAACCTACATTT AGG (reversed) Intergenic
No off target data available for this crispr