ID: 1094386451

View in Genome Browser
Species Human (GRCh38)
Location 12:29899462-29899484
Sequence TCTAGGAAGCAGATTCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094386443_1094386451 21 Left 1094386443 12:29899418-29899440 CCAGGAAATAGGGGTGGAATAGG No data
Right 1094386451 12:29899462-29899484 TCTAGGAAGCAGATTCTCATGGG No data
1094386449_1094386451 -10 Left 1094386449 12:29899449-29899471 CCTAAATGTAGGTTCTAGGAAGC No data
Right 1094386451 12:29899462-29899484 TCTAGGAAGCAGATTCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094386451 Original CRISPR TCTAGGAAGCAGATTCTCAT GGG Intergenic
No off target data available for this crispr