ID: 1094398531

View in Genome Browser
Species Human (GRCh38)
Location 12:30035340-30035362
Sequence GAGAATTTGGGTACAGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094398531_1094398535 -2 Left 1094398531 12:30035340-30035362 CCAAATTCTGTACCCAAATTCTC No data
Right 1094398535 12:30035361-30035383 TCATTGTTATTCCCGCTAAAGGG No data
1094398531_1094398538 23 Left 1094398531 12:30035340-30035362 CCAAATTCTGTACCCAAATTCTC No data
Right 1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG No data
1094398531_1094398534 -3 Left 1094398531 12:30035340-30035362 CCAAATTCTGTACCCAAATTCTC No data
Right 1094398534 12:30035360-30035382 CTCATTGTTATTCCCGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094398531 Original CRISPR GAGAATTTGGGTACAGAATT TGG (reversed) Intergenic
No off target data available for this crispr