ID: 1094398533

View in Genome Browser
Species Human (GRCh38)
Location 12:30035353-30035375
Sequence CGGGAATAACAATGAGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094398533_1094398538 10 Left 1094398533 12:30035353-30035375 CCAAATTCTCATTGTTATTCCCG No data
Right 1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094398533 Original CRISPR CGGGAATAACAATGAGAATT TGG (reversed) Intergenic
No off target data available for this crispr