ID: 1094398536

View in Genome Browser
Species Human (GRCh38)
Location 12:30035372-30035394
Sequence TAGAAACTGTGCCCTTTAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094398536_1094398538 -9 Left 1094398536 12:30035372-30035394 CCCGCTAAAGGGCACAGTTTCTA No data
Right 1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG No data
1094398536_1094398539 27 Left 1094398536 12:30035372-30035394 CCCGCTAAAGGGCACAGTTTCTA No data
Right 1094398539 12:30035422-30035444 CAAGTAAGAAGCTGAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094398536 Original CRISPR TAGAAACTGTGCCCTTTAGC GGG (reversed) Intergenic
No off target data available for this crispr