ID: 1094398536 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:30035372-30035394 |
| Sequence | TAGAAACTGTGCCCTTTAGC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1094398536_1094398538 | -9 | Left | 1094398536 | 12:30035372-30035394 | CCCGCTAAAGGGCACAGTTTCTA | No data | ||
| Right | 1094398538 | 12:30035386-30035408 | CAGTTTCTAGAGATGCAGCATGG | No data | ||||
| 1094398536_1094398539 | 27 | Left | 1094398536 | 12:30035372-30035394 | CCCGCTAAAGGGCACAGTTTCTA | No data | ||
| Right | 1094398539 | 12:30035422-30035444 | CAAGTAAGAAGCTGAGCTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1094398536 | Original CRISPR | TAGAAACTGTGCCCTTTAGC GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||