ID: 1094398537

View in Genome Browser
Species Human (GRCh38)
Location 12:30035373-30035395
Sequence CTAGAAACTGTGCCCTTTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094398537_1094398538 -10 Left 1094398537 12:30035373-30035395 CCGCTAAAGGGCACAGTTTCTAG No data
Right 1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG No data
1094398537_1094398539 26 Left 1094398537 12:30035373-30035395 CCGCTAAAGGGCACAGTTTCTAG No data
Right 1094398539 12:30035422-30035444 CAAGTAAGAAGCTGAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094398537 Original CRISPR CTAGAAACTGTGCCCTTTAG CGG (reversed) Intergenic
No off target data available for this crispr