ID: 1094398538

View in Genome Browser
Species Human (GRCh38)
Location 12:30035386-30035408
Sequence CAGTTTCTAGAGATGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094398537_1094398538 -10 Left 1094398537 12:30035373-30035395 CCGCTAAAGGGCACAGTTTCTAG No data
Right 1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG No data
1094398533_1094398538 10 Left 1094398533 12:30035353-30035375 CCAAATTCTCATTGTTATTCCCG No data
Right 1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG No data
1094398532_1094398538 11 Left 1094398532 12:30035352-30035374 CCCAAATTCTCATTGTTATTCCC No data
Right 1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG No data
1094398531_1094398538 23 Left 1094398531 12:30035340-30035362 CCAAATTCTGTACCCAAATTCTC No data
Right 1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG No data
1094398536_1094398538 -9 Left 1094398536 12:30035372-30035394 CCCGCTAAAGGGCACAGTTTCTA No data
Right 1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094398538 Original CRISPR CAGTTTCTAGAGATGCAGCA TGG Intergenic
No off target data available for this crispr