ID: 1094404452

View in Genome Browser
Species Human (GRCh38)
Location 12:30100433-30100455
Sequence AGGGAAACTTTTGGAGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094404452_1094404459 18 Left 1094404452 12:30100433-30100455 CCATCACCTCCAAAAGTTTCCCT No data
Right 1094404459 12:30100474-30100496 CTCAATCCCATCCCTAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094404452 Original CRISPR AGGGAAACTTTTGGAGGTGA TGG (reversed) Intergenic
No off target data available for this crispr