ID: 1094404454

View in Genome Browser
Species Human (GRCh38)
Location 12:30100442-30100464
Sequence AGACTGCACAGGGAAACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094404454_1094404459 9 Left 1094404454 12:30100442-30100464 CCAAAAGTTTCCCTGTGCAGTCT No data
Right 1094404459 12:30100474-30100496 CTCAATCCCATCCCTAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094404454 Original CRISPR AGACTGCACAGGGAAACTTT TGG (reversed) Intergenic
No off target data available for this crispr